ID: 958076138

View in Genome Browser
Species Human (GRCh38)
Location 3:88681115-88681137
Sequence ATATATCTAGAGATGAAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958076137_958076138 6 Left 958076137 3:88681086-88681108 CCAAAAAGTTTTGTTTTTCACAT No data
Right 958076138 3:88681115-88681137 ATATATCTAGAGATGAAGCAAGG No data
958076135_958076138 25 Left 958076135 3:88681067-88681089 CCTAAACATATCCAGATTGCCAA No data
Right 958076138 3:88681115-88681137 ATATATCTAGAGATGAAGCAAGG No data
958076136_958076138 14 Left 958076136 3:88681078-88681100 CCAGATTGCCAAAAAGTTTTGTT No data
Right 958076138 3:88681115-88681137 ATATATCTAGAGATGAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958076138 Original CRISPR ATATATCTAGAGATGAAGCA AGG Intergenic
No off target data available for this crispr