ID: 958077687

View in Genome Browser
Species Human (GRCh38)
Location 3:88704257-88704279
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958077682_958077687 4 Left 958077682 3:88704230-88704252 CCTCTTTGGATTGATTGTAAATA No data
Right 958077687 3:88704257-88704279 GATGGGTATTTACTGTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr