ID: 958079538

View in Genome Browser
Species Human (GRCh38)
Location 3:88728660-88728682
Sequence CTGTGCATCTGGCTGACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958079536_958079538 5 Left 958079536 3:88728632-88728654 CCTCAGAGACTCAGTCTTTTACT No data
Right 958079538 3:88728660-88728682 CTGTGCATCTGGCTGACAGATGG No data
958079534_958079538 10 Left 958079534 3:88728627-88728649 CCATCCCTCAGAGACTCAGTCTT No data
Right 958079538 3:88728660-88728682 CTGTGCATCTGGCTGACAGATGG No data
958079535_958079538 6 Left 958079535 3:88728631-88728653 CCCTCAGAGACTCAGTCTTTTAC No data
Right 958079538 3:88728660-88728682 CTGTGCATCTGGCTGACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958079538 Original CRISPR CTGTGCATCTGGCTGACAGA TGG Intergenic
No off target data available for this crispr