ID: 958086401

View in Genome Browser
Species Human (GRCh38)
Location 3:88813686-88813708
Sequence GTATCTGGTTAGTATGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958086401_958086404 8 Left 958086401 3:88813686-88813708 CCTTACTCATACTAACCAGATAC No data
Right 958086404 3:88813717-88813739 CTAAATATGGTCCCTGAGCCAGG No data
958086401_958086403 -5 Left 958086401 3:88813686-88813708 CCTTACTCATACTAACCAGATAC No data
Right 958086403 3:88813704-88813726 GATACAGTATTTTCTAAATATGG No data
958086401_958086405 16 Left 958086401 3:88813686-88813708 CCTTACTCATACTAACCAGATAC No data
Right 958086405 3:88813725-88813747 GGTCCCTGAGCCAGGTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958086401 Original CRISPR GTATCTGGTTAGTATGAGTA AGG (reversed) Intergenic
No off target data available for this crispr