ID: 958089869

View in Genome Browser
Species Human (GRCh38)
Location 3:88862983-88863005
Sequence CATATTAAGCACTATGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958089868_958089869 13 Left 958089868 3:88862947-88862969 CCTAAGAGTTGTCTTAACATAAT No data
Right 958089869 3:88862983-88863005 CATATTAAGCACTATGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958089869 Original CRISPR CATATTAAGCACTATGATCA AGG Intergenic
No off target data available for this crispr