ID: 958091322

View in Genome Browser
Species Human (GRCh38)
Location 3:88880166-88880188
Sequence AGATTTTGGGGTGCAGCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958091311_958091322 25 Left 958091311 3:88880118-88880140 CCTGGCAGCAGTCCCTGGGATGT No data
Right 958091322 3:88880166-88880188 AGATTTTGGGGTGCAGCAACTGG No data
958091318_958091322 -2 Left 958091318 3:88880145-88880167 CCTAAGTATGGATGGGGTAATAG No data
Right 958091322 3:88880166-88880188 AGATTTTGGGGTGCAGCAACTGG No data
958091313_958091322 12 Left 958091313 3:88880131-88880153 CCTGGGATGTTTAGCCTAAGTAT No data
Right 958091322 3:88880166-88880188 AGATTTTGGGGTGCAGCAACTGG No data
958091312_958091322 13 Left 958091312 3:88880130-88880152 CCCTGGGATGTTTAGCCTAAGTA No data
Right 958091322 3:88880166-88880188 AGATTTTGGGGTGCAGCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958091322 Original CRISPR AGATTTTGGGGTGCAGCAAC TGG Intergenic
No off target data available for this crispr