ID: 958095254

View in Genome Browser
Species Human (GRCh38)
Location 3:88935954-88935976
Sequence ATCTGAATCTAGGAATATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958095254_958095257 -7 Left 958095254 3:88935954-88935976 CCTGCATATTCCTAGATTCAGAT No data
Right 958095257 3:88935970-88935992 TTCAGATAAATGAGGTAGATTGG No data
958095254_958095258 11 Left 958095254 3:88935954-88935976 CCTGCATATTCCTAGATTCAGAT No data
Right 958095258 3:88935988-88936010 ATTGGCCACATTTTCTAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958095254 Original CRISPR ATCTGAATCTAGGAATATGC AGG (reversed) Intergenic
No off target data available for this crispr