ID: 958096375

View in Genome Browser
Species Human (GRCh38)
Location 3:88950810-88950832
Sequence GTGGCTGTGTATAGGCATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958096375 Original CRISPR GTGGCTGTGTATAGGCATTC TGG (reversed) Intergenic
900490275 1:2945316-2945338 GTGTCTGTGTATACGCATGTTGG + Intergenic
902873832 1:19329364-19329386 GTGGATGTGGATGGGGATTCAGG + Intergenic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
910616900 1:89208367-89208389 GTTGCTTTGTACAGTCATTCAGG - Intergenic
912585018 1:110754461-110754483 GTGTCTGTGTGCATGCATTCAGG + Intergenic
916723681 1:167504068-167504090 GGTGCTGTGTATAGGCAATGCGG + Intronic
919043559 1:192423893-192423915 ATGGCTGACTAGAGGCATTCAGG + Intergenic
919343294 1:196341968-196341990 GTTCATGTGTTTAGGCATTCCGG - Intronic
922474902 1:225899949-225899971 GTGGCAGTGGAAGGGCATTCGGG - Intronic
924632036 1:245750369-245750391 GAGGCCGTGTACAGGCACTCTGG + Intronic
1064483813 10:15765304-15765326 GAGGCTTTGTATAGTCATTCGGG + Intergenic
1068322828 10:55442046-55442068 ATGGCTGAGTTTTGGCATTCTGG + Intronic
1069508817 10:69024845-69024867 GTGGAGGTGTGGAGGCATTCAGG + Intergenic
1077152020 11:1076869-1076891 GTGGGTGGGTAGAGGCTTTCAGG + Intergenic
1080477038 11:32605261-32605283 GTGGCTGACTATAGGATTTCAGG - Exonic
1084288271 11:68145838-68145860 TTGGCTGTGCAAAGGCAGTCGGG + Intergenic
1084774675 11:71367669-71367691 GGGGCTCTGGAAAGGCATTCTGG - Intergenic
1085937519 11:81167009-81167031 TTGATTATGTATAGGCATTCTGG - Intergenic
1089092197 11:115887436-115887458 GTGGCTGTGTGGAGAGATTCGGG + Intergenic
1093019385 12:14188946-14188968 CTGGCAGTATATAGGCTTTCTGG + Intergenic
1093235572 12:16605450-16605472 GTGGCTGTGTTTGGGCATGGGGG - Intronic
1102777180 12:115530654-115530676 GTGGCTGTGAATATAAATTCTGG - Intergenic
1103211961 12:119173692-119173714 GTAGCTGTGTCTAGGCAATCCGG - Intergenic
1107240063 13:38222222-38222244 ATGGCTGTGTACAAGCATTTAGG + Intergenic
1112833170 13:103478572-103478594 GTCTCTGTGTATAGTCATTTAGG + Intergenic
1114876633 14:26728168-26728190 CTGGCAGTGCACAGGCATTCAGG - Intergenic
1115957980 14:38803019-38803041 GTTGCTGTGTATAGTAATTTTGG - Intergenic
1117052123 14:51871198-51871220 ATTGCTGTGTATAGGCATTAAGG + Intronic
1121290828 14:92773650-92773672 TTGGTTGTGTATGGGCATTTGGG - Intergenic
1121627641 14:95398304-95398326 GTGTGTGTGCATAGGCACTCAGG + Intergenic
1122955581 14:105069194-105069216 GTCTCTGTGTTTAGCCATTCAGG + Intergenic
1123080321 14:105690183-105690205 GTGAATGTGTATAGGCATATGGG - Intergenic
1130808206 15:87349526-87349548 GTGGGTGGGTATTGGCATTGAGG - Intergenic
1138133264 16:54500164-54500186 GTGGCTGTGTTTAGGGAGTGTGG - Intergenic
1139640561 16:68288576-68288598 GTGGCTGTGTACAGTCACCCGGG + Intronic
1141168970 16:81679292-81679314 GTGGGTGTGTCTAGGCACTTGGG + Intronic
1145244375 17:21258623-21258645 GTGGCTGTGCAGAGGCCTTGGGG + Intergenic
1151016225 17:70556686-70556708 GTGTGTGTGTATAGCCATTATGG + Intergenic
1152460368 17:80439142-80439164 GTGGCTGTGCACAGGCAACCAGG + Intergenic
1153815770 18:8788741-8788763 GTGGCTGTTTATAAGAATGCCGG - Intronic
1155080009 18:22399850-22399872 GTGGTTGTTAATAGTCATTCTGG - Intergenic
1158397870 18:57093818-57093840 GTGTTTGTGTATAGGCATGTAGG - Intergenic
1165301845 19:34974934-34974956 GTGGGTTTGTTTAGTCATTCTGG + Intergenic
925005924 2:443065-443087 GTGGCTGTGTAGGGGCAGTGTGG - Intergenic
925459424 2:4047460-4047482 ATGACTGTGTATAGTCATGCTGG - Intergenic
928160216 2:28916610-28916632 GTGGGTGTGTGTAGGTGTTCGGG - Intronic
932455761 2:71849013-71849035 GTGGCTCTGCCTGGGCATTCGGG + Intergenic
933114479 2:78450330-78450352 TTGGCTGTGAATGGGCATTTTGG - Intergenic
936392011 2:112083646-112083668 GGGGCTGTGTAGAGGCTTCCAGG + Intronic
939989525 2:148864396-148864418 GCGGCTGTGTATTGCCATTGTGG + Intergenic
943683756 2:190794700-190794722 GTGGCCATGTGTAGGTATTCTGG + Intergenic
946831698 2:223734407-223734429 GTGGGAGAGTATAGGCATCCTGG - Intergenic
1171272025 20:23824943-23824965 GTGCCTGTGTGTGGGGATTCTGG - Intronic
1174454493 20:50639723-50639745 GTGCTTGTGTATAGGCAGTGTGG + Intronic
1175297971 20:57922344-57922366 GTGTGTGTGCATAGGCATTGTGG - Intergenic
1178487789 21:33029891-33029913 GTGGCTGTGAAGAGAGATTCTGG + Intergenic
1182503637 22:30766513-30766535 TTGGCAGTGTCCAGGCATTCAGG + Intronic
1183980778 22:41538822-41538844 GTGTCTGTGTCCAGCCATTCAGG - Intronic
951650270 3:24944003-24944025 GTCTCTGTATATAGTCATTCAGG + Intergenic
951914232 3:27782458-27782480 GAGGCTATGTATAGGTACTCTGG + Intergenic
955202277 3:56861969-56861991 GTTGCTGTGTATAGGTTTTAGGG - Intronic
955749995 3:62177798-62177820 GTGGCTGGGTCAAGGCAGTCAGG - Intronic
958096375 3:88950810-88950832 GTGGCTGTGTATAGGCATTCTGG - Intergenic
967941965 3:194773081-194773103 CTGGCAGTGCATAAGCATTCCGG - Intergenic
970519265 4:16865700-16865722 GTGGCTGTCTACAGTCACTCTGG + Intronic
970723160 4:19011135-19011157 GTGGCTATTTAAAGGCATCCTGG + Intergenic
972352741 4:38251968-38251990 AGGGCTGTGTATAGGGATTTAGG + Intergenic
974344846 4:60666053-60666075 GTGGCTGTTTATAAACATTCAGG + Intergenic
975093502 4:70430606-70430628 GTTACTGTGTCTAGGCATTTTGG - Exonic
979857077 4:125647110-125647132 GTGACTATGTATAAGCATTAAGG + Intergenic
980200709 4:129652586-129652608 TTGGATGTGAAGAGGCATTCTGG - Intergenic
982122312 4:152155121-152155143 TTGGCTGAGTATTGGCAGTCAGG + Intergenic
984936626 4:184895479-184895501 GTGGCTGTGCACATGCTTTCAGG - Intergenic
985383847 4:189424601-189424623 GTGTGTGTGTATATGCATACAGG - Intergenic
985940984 5:3135653-3135675 TTGGCTGTGTAGAGGCATGATGG - Intergenic
989394075 5:40934340-40934362 GTTGCTGTGTATGGGCAGTATGG + Exonic
999087260 5:148903911-148903933 GTGGATGGGTAAAAGCATTCTGG - Intergenic
1008662017 6:53678186-53678208 GTGGTGGTGAATAGGCATACAGG + Intergenic
1010377230 6:75185304-75185326 GTTGTTGTGTATAGGAATGCTGG - Intronic
1010804375 6:80217628-80217650 GTGGCTGTGTTTAGGGAGTAGGG - Intronic
1011423791 6:87203725-87203747 GTGGCTGTGTGTGGGGATTTAGG + Intronic
1013550725 6:111205268-111205290 GTGGCAGTGCATAGACTTTCTGG - Intronic
1016448598 6:144157723-144157745 GTGGCTGAGTTTAGCCACTCTGG - Intronic
1019331822 7:464080-464102 GTGGCTGTGTCCAGGCAGGCGGG + Intergenic
1020393617 7:7687566-7687588 GTGGGTGTGAATAGACTTTCTGG - Intronic
1023348564 7:39296540-39296562 GAGGCTGTGTTTAGGGATTTTGG - Intronic
1029498746 7:100914334-100914356 GTGGCTGTGCATGGGATTTCAGG + Intergenic
1035965643 8:4188529-4188551 GAGGCTGTCTTTAGGAATTCAGG + Intronic
1042055340 8:64758281-64758303 GAGGCTGTGTCTGGGCTTTCTGG - Intronic
1045486370 8:102634704-102634726 CTGGATCTGTAAAGGCATTCTGG + Intergenic
1045537676 8:103047613-103047635 GAGGCTGTGTATCTGCAATCTGG + Intronic
1048274927 8:133058929-133058951 GTGGCTGGGTCTTGGCATGCTGG + Intronic
1052071960 9:24092719-24092741 GTGGCTTGGTACATGCATTCTGG - Intergenic
1052275380 9:26669806-26669828 GTGGCTGTGCATGTGCACTCAGG + Intergenic
1056638893 9:88353509-88353531 GCTGCTGTGTATTTGCATTCTGG + Intergenic
1057217082 9:93235040-93235062 GTGGCTCTGTAAAGCCATCCTGG + Intronic
1057230178 9:93317188-93317210 GTGGCTGAGTAGAGGCATGTGGG + Intronic
1059538301 9:115104875-115104897 GTGGCTATGATTAGGCTTTCGGG + Intronic
1186097491 X:6117694-6117716 GGGGCTGTGAATAGACTTTCAGG - Intronic
1189978352 X:46485433-46485455 TTGGATGTTTAGAGGCATTCTGG + Intronic
1192935123 X:75850887-75850909 GTGGCTGTGTGAGAGCATTCAGG + Intergenic
1193201898 X:78701337-78701359 GCTGCTATGTATAGGTATTCAGG + Intergenic
1196501473 X:116388271-116388293 GTTTCTCTGTACAGGCATTCTGG + Intergenic