ID: 958097414

View in Genome Browser
Species Human (GRCh38)
Location 3:88964256-88964278
Sequence TAGGTGCAGGACTTAATCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958097414_958097420 30 Left 958097414 3:88964256-88964278 CCTGTGATTAAGTCCTGCACCTA No data
Right 958097420 3:88964309-88964331 AAAGTGAAATTTTATTTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958097414 Original CRISPR TAGGTGCAGGACTTAATCAC AGG (reversed) Intergenic
No off target data available for this crispr