ID: 958098890

View in Genome Browser
Species Human (GRCh38)
Location 3:88983491-88983513
Sequence GGGATGCTAATAATTCTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958098890_958098901 13 Left 958098890 3:88983491-88983513 CCACCTAGAATTATTAGCATCCC No data
Right 958098901 3:88983527-88983549 GCTAGAAATGTTTGGAAAATTGG No data
958098890_958098903 15 Left 958098890 3:88983491-88983513 CCACCTAGAATTATTAGCATCCC No data
Right 958098903 3:88983529-88983551 TAGAAATGTTTGGAAAATTGGGG No data
958098890_958098899 5 Left 958098890 3:88983491-88983513 CCACCTAGAATTATTAGCATCCC No data
Right 958098899 3:88983519-88983541 CCACCACTGCTAGAAATGTTTGG No data
958098890_958098902 14 Left 958098890 3:88983491-88983513 CCACCTAGAATTATTAGCATCCC No data
Right 958098902 3:88983528-88983550 CTAGAAATGTTTGGAAAATTGGG No data
958098890_958098904 16 Left 958098890 3:88983491-88983513 CCACCTAGAATTATTAGCATCCC No data
Right 958098904 3:88983530-88983552 AGAAATGTTTGGAAAATTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958098890 Original CRISPR GGGATGCTAATAATTCTAGG TGG (reversed) Intergenic
No off target data available for this crispr