ID: 958098891

View in Genome Browser
Species Human (GRCh38)
Location 3:88983494-88983516
Sequence AGGGGGATGCTAATAATTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958098891_958098901 10 Left 958098891 3:88983494-88983516 CCTAGAATTATTAGCATCCCCCT No data
Right 958098901 3:88983527-88983549 GCTAGAAATGTTTGGAAAATTGG No data
958098891_958098902 11 Left 958098891 3:88983494-88983516 CCTAGAATTATTAGCATCCCCCT No data
Right 958098902 3:88983528-88983550 CTAGAAATGTTTGGAAAATTGGG No data
958098891_958098904 13 Left 958098891 3:88983494-88983516 CCTAGAATTATTAGCATCCCCCT No data
Right 958098904 3:88983530-88983552 AGAAATGTTTGGAAAATTGGGGG No data
958098891_958098903 12 Left 958098891 3:88983494-88983516 CCTAGAATTATTAGCATCCCCCT No data
Right 958098903 3:88983529-88983551 TAGAAATGTTTGGAAAATTGGGG No data
958098891_958098899 2 Left 958098891 3:88983494-88983516 CCTAGAATTATTAGCATCCCCCT No data
Right 958098899 3:88983519-88983541 CCACCACTGCTAGAAATGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958098891 Original CRISPR AGGGGGATGCTAATAATTCT AGG (reversed) Intergenic
No off target data available for this crispr