ID: 958098893

View in Genome Browser
Species Human (GRCh38)
Location 3:88983512-88983534
Sequence TTTCTAGCAGTGGTGGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958098893_958098901 -8 Left 958098893 3:88983512-88983534 CCCCTCCCCACCACTGCTAGAAA No data
Right 958098901 3:88983527-88983549 GCTAGAAATGTTTGGAAAATTGG No data
958098893_958098904 -5 Left 958098893 3:88983512-88983534 CCCCTCCCCACCACTGCTAGAAA No data
Right 958098904 3:88983530-88983552 AGAAATGTTTGGAAAATTGGGGG No data
958098893_958098902 -7 Left 958098893 3:88983512-88983534 CCCCTCCCCACCACTGCTAGAAA No data
Right 958098902 3:88983528-88983550 CTAGAAATGTTTGGAAAATTGGG No data
958098893_958098903 -6 Left 958098893 3:88983512-88983534 CCCCTCCCCACCACTGCTAGAAA No data
Right 958098903 3:88983529-88983551 TAGAAATGTTTGGAAAATTGGGG No data
958098893_958098906 22 Left 958098893 3:88983512-88983534 CCCCTCCCCACCACTGCTAGAAA No data
Right 958098906 3:88983557-88983579 TTAGAAGCAACACATACTTTGGG No data
958098893_958098905 21 Left 958098893 3:88983512-88983534 CCCCTCCCCACCACTGCTAGAAA No data
Right 958098905 3:88983556-88983578 TTTAGAAGCAACACATACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958098893 Original CRISPR TTTCTAGCAGTGGTGGGGAG GGG (reversed) Intergenic
No off target data available for this crispr