ID: 958098895

View in Genome Browser
Species Human (GRCh38)
Location 3:88983514-88983536
Sequence CATTTCTAGCAGTGGTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958098895_958098906 20 Left 958098895 3:88983514-88983536 CCTCCCCACCACTGCTAGAAATG No data
Right 958098906 3:88983557-88983579 TTAGAAGCAACACATACTTTGGG No data
958098895_958098905 19 Left 958098895 3:88983514-88983536 CCTCCCCACCACTGCTAGAAATG No data
Right 958098905 3:88983556-88983578 TTTAGAAGCAACACATACTTTGG No data
958098895_958098902 -9 Left 958098895 3:88983514-88983536 CCTCCCCACCACTGCTAGAAATG No data
Right 958098902 3:88983528-88983550 CTAGAAATGTTTGGAAAATTGGG No data
958098895_958098904 -7 Left 958098895 3:88983514-88983536 CCTCCCCACCACTGCTAGAAATG No data
Right 958098904 3:88983530-88983552 AGAAATGTTTGGAAAATTGGGGG No data
958098895_958098901 -10 Left 958098895 3:88983514-88983536 CCTCCCCACCACTGCTAGAAATG No data
Right 958098901 3:88983527-88983549 GCTAGAAATGTTTGGAAAATTGG No data
958098895_958098903 -8 Left 958098895 3:88983514-88983536 CCTCCCCACCACTGCTAGAAATG No data
Right 958098903 3:88983529-88983551 TAGAAATGTTTGGAAAATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958098895 Original CRISPR CATTTCTAGCAGTGGTGGGG AGG (reversed) Intergenic
No off target data available for this crispr