ID: 958098903

View in Genome Browser
Species Human (GRCh38)
Location 3:88983529-88983551
Sequence TAGAAATGTTTGGAAAATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958098890_958098903 15 Left 958098890 3:88983491-88983513 CCACCTAGAATTATTAGCATCCC No data
Right 958098903 3:88983529-88983551 TAGAAATGTTTGGAAAATTGGGG No data
958098889_958098903 16 Left 958098889 3:88983490-88983512 CCCACCTAGAATTATTAGCATCC No data
Right 958098903 3:88983529-88983551 TAGAAATGTTTGGAAAATTGGGG No data
958098893_958098903 -6 Left 958098893 3:88983512-88983534 CCCCTCCCCACCACTGCTAGAAA No data
Right 958098903 3:88983529-88983551 TAGAAATGTTTGGAAAATTGGGG No data
958098891_958098903 12 Left 958098891 3:88983494-88983516 CCTAGAATTATTAGCATCCCCCT No data
Right 958098903 3:88983529-88983551 TAGAAATGTTTGGAAAATTGGGG No data
958098892_958098903 -5 Left 958098892 3:88983511-88983533 CCCCCTCCCCACCACTGCTAGAA No data
Right 958098903 3:88983529-88983551 TAGAAATGTTTGGAAAATTGGGG No data
958098894_958098903 -7 Left 958098894 3:88983513-88983535 CCCTCCCCACCACTGCTAGAAAT No data
Right 958098903 3:88983529-88983551 TAGAAATGTTTGGAAAATTGGGG No data
958098895_958098903 -8 Left 958098895 3:88983514-88983536 CCTCCCCACCACTGCTAGAAATG No data
Right 958098903 3:88983529-88983551 TAGAAATGTTTGGAAAATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958098903 Original CRISPR TAGAAATGTTTGGAAAATTG GGG Intergenic
No off target data available for this crispr