ID: 958098906

View in Genome Browser
Species Human (GRCh38)
Location 3:88983557-88983579
Sequence TTAGAAGCAACACATACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958098898_958098906 15 Left 958098898 3:88983519-88983541 CCACCACTGCTAGAAATGTTTGG No data
Right 958098906 3:88983557-88983579 TTAGAAGCAACACATACTTTGGG No data
958098900_958098906 12 Left 958098900 3:88983522-88983544 CCACTGCTAGAAATGTTTGGAAA No data
Right 958098906 3:88983557-88983579 TTAGAAGCAACACATACTTTGGG No data
958098896_958098906 17 Left 958098896 3:88983517-88983539 CCCCACCACTGCTAGAAATGTTT No data
Right 958098906 3:88983557-88983579 TTAGAAGCAACACATACTTTGGG No data
958098893_958098906 22 Left 958098893 3:88983512-88983534 CCCCTCCCCACCACTGCTAGAAA No data
Right 958098906 3:88983557-88983579 TTAGAAGCAACACATACTTTGGG No data
958098892_958098906 23 Left 958098892 3:88983511-88983533 CCCCCTCCCCACCACTGCTAGAA No data
Right 958098906 3:88983557-88983579 TTAGAAGCAACACATACTTTGGG No data
958098894_958098906 21 Left 958098894 3:88983513-88983535 CCCTCCCCACCACTGCTAGAAAT No data
Right 958098906 3:88983557-88983579 TTAGAAGCAACACATACTTTGGG No data
958098895_958098906 20 Left 958098895 3:88983514-88983536 CCTCCCCACCACTGCTAGAAATG No data
Right 958098906 3:88983557-88983579 TTAGAAGCAACACATACTTTGGG No data
958098897_958098906 16 Left 958098897 3:88983518-88983540 CCCACCACTGCTAGAAATGTTTG No data
Right 958098906 3:88983557-88983579 TTAGAAGCAACACATACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958098906 Original CRISPR TTAGAAGCAACACATACTTT GGG Intergenic
No off target data available for this crispr