ID: 958105522 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:89067745-89067767 |
| Sequence | TTCTCTGTCACTAAAGAGGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 958105518_958105522 | 3 | Left | 958105518 | 3:89067719-89067741 | CCAAAACACATTTCAGTGGTGCC | No data | ||
| Right | 958105522 | 3:89067745-89067767 | TTCTCTGTCACTAAAGAGGATGG | No data | ||||
| 958105517_958105522 | 4 | Left | 958105517 | 3:89067718-89067740 | CCCAAAACACATTTCAGTGGTGC | No data | ||
| Right | 958105522 | 3:89067745-89067767 | TTCTCTGTCACTAAAGAGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 958105522 | Original CRISPR | TTCTCTGTCACTAAAGAGGA TGG | Intergenic | ||
| No off target data available for this crispr | |||||