ID: 958105522

View in Genome Browser
Species Human (GRCh38)
Location 3:89067745-89067767
Sequence TTCTCTGTCACTAAAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958105518_958105522 3 Left 958105518 3:89067719-89067741 CCAAAACACATTTCAGTGGTGCC No data
Right 958105522 3:89067745-89067767 TTCTCTGTCACTAAAGAGGATGG No data
958105517_958105522 4 Left 958105517 3:89067718-89067740 CCCAAAACACATTTCAGTGGTGC No data
Right 958105522 3:89067745-89067767 TTCTCTGTCACTAAAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958105522 Original CRISPR TTCTCTGTCACTAAAGAGGA TGG Intergenic
No off target data available for this crispr