ID: 958112177

View in Genome Browser
Species Human (GRCh38)
Location 3:89162713-89162735
Sequence CAGTTCCAGCATGCAGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958112177_958112186 22 Left 958112177 3:89162713-89162735 CCCAACCCTGCATGCTGGAACTG 0: 1
1: 0
2: 2
3: 32
4: 218
Right 958112186 3:89162758-89162780 TGAATTGGGCTGAGATTGCAAGG 0: 1
1: 0
2: 2
3: 14
4: 184
958112177_958112185 8 Left 958112177 3:89162713-89162735 CCCAACCCTGCATGCTGGAACTG 0: 1
1: 0
2: 2
3: 32
4: 218
Right 958112185 3:89162744-89162766 TTTTAGAAAGATCTTGAATTGGG 0: 1
1: 0
2: 5
3: 55
4: 536
958112177_958112184 7 Left 958112177 3:89162713-89162735 CCCAACCCTGCATGCTGGAACTG 0: 1
1: 0
2: 2
3: 32
4: 218
Right 958112184 3:89162743-89162765 CTTTTAGAAAGATCTTGAATTGG 0: 1
1: 1
2: 4
3: 36
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958112177 Original CRISPR CAGTTCCAGCATGCAGGGTT GGG (reversed) Intronic
900315452 1:2053946-2053968 CAGTTCCAGCAGGAAGGGGTGGG + Intronic
901206253 1:7497479-7497501 GATTGCCAGCATGCAGGGCTGGG - Intronic
902546306 1:17192857-17192879 CAGCAGCAGCATGCAAGGTTGGG + Intergenic
902917165 1:19645731-19645753 GAGGTCCAGCTTGCAGGGGTGGG - Intronic
904937816 1:34144251-34144273 CAGATTCACCATGCAGTGTTAGG + Intronic
905266992 1:36761154-36761176 CTGTCCCACCATGCAGGGTGAGG - Intergenic
905637578 1:39565131-39565153 CAGTTCCAGCCTGCAGCGGGTGG - Exonic
906687361 1:47771324-47771346 GAGTTCCACCATGCAGGGGGAGG - Intronic
908014406 1:59815604-59815626 TAGTTTGAGGATGCAGGGTTAGG - Intronic
909759571 1:79271156-79271178 CCTTTCCAGCTTGCAGGTTTAGG + Intergenic
909759625 1:79271432-79271454 CTGTTCCAGCCTGCAGACTTAGG + Intergenic
909854097 1:80506460-80506482 CAGTCTCAGCATGCAGGCTGTGG + Intergenic
910340858 1:86185270-86185292 GAGTTCCAGGATGAAAGGTTTGG + Intergenic
912893174 1:113557360-113557382 CTGTTCCAGCCTGCAGGCTTTGG + Intronic
913659617 1:120994652-120994674 CAGTTTCAGCATTCAGTGTGGGG - Intergenic
914010978 1:143777776-143777798 CAGTTTCAGCATTCAGTGTGGGG - Intergenic
914166853 1:145183336-145183358 CAGTTTCAGCATTCAGTGTGGGG + Intergenic
914649599 1:149686436-149686458 CAGTTTCAGCATTCAGTGTGGGG - Intergenic
915390220 1:155536234-155536256 CAGTTCCAGGAAGCCGGGTTGGG - Intronic
915631725 1:157157907-157157929 CAGTACCCGCAGGCAGGGTTGGG - Intergenic
915995454 1:160558043-160558065 CTGTTCCAGCCTGCTGGCTTTGG + Intronic
916594841 1:166234016-166234038 CCATTCCAGCCTGCAGGCTTTGG - Intergenic
917714613 1:177721868-177721890 CAGTTCCAGCCTTCAGGCTATGG + Intergenic
917997899 1:180460336-180460358 CCGTTCCAGCCTCCAGGCTTTGG + Intronic
920646150 1:207805902-207805924 CAGCACAAGCAAGCAGGGTTAGG - Intergenic
922191609 1:223323605-223323627 CAGGTACAGGATGCAGGGTGAGG + Intronic
923777907 1:236996346-236996368 TAGTTCCAGCATTCAGGTTCTGG + Intergenic
923953390 1:238987350-238987372 GAGTACCAGGATGCAGGGATTGG - Intergenic
1065173799 10:23057516-23057538 GAGTTACAGCATTCAGGTTTGGG + Intergenic
1068186620 10:53593823-53593845 CCATTCCAGCCTGCAGGCTTTGG - Intergenic
1068238669 10:54274043-54274065 GAGTTAGAGCATGCAGTGTTTGG - Intronic
1069822133 10:71234762-71234784 CAGTTCCAGGCTGCTGGGTCTGG + Intronic
1074191350 10:111140181-111140203 GAATTCCAGCCTGCAGGGTGGGG - Intergenic
1074270078 10:111945033-111945055 CTGTTCCAGCCTGAAGGCTTAGG + Intergenic
1074790956 10:116887385-116887407 CAGCTGCAGCAGGCAGGGCTGGG + Intronic
1077050661 11:565105-565127 CAGCTCCAGGATCCATGGTTGGG + Intergenic
1077299881 11:1841943-1841965 CACATCCAACATGCAGGGCTGGG + Intergenic
1077802738 11:5557370-5557392 CATTTTCATCATGCATGGTTCGG - Intronic
1078319445 11:10320905-10320927 CAGTTCCAGAGAGCAGGGTTTGG + Intronic
1080961621 11:37167776-37167798 CAGTTCCAGGCTTCAGGGTGGGG - Intergenic
1083996348 11:66274911-66274933 CAGTTCCCACCTGCAGGCTTAGG + Intronic
1084542963 11:69798670-69798692 CACTTCCAGTATCCAGGGCTGGG + Intergenic
1085528934 11:77180275-77180297 CAGTTCCAGAACTCAGAGTTGGG + Intronic
1086895284 11:92304860-92304882 CAGTTGCATCATGCTGGGTGAGG + Intergenic
1086990977 11:93303677-93303699 CTGTTCCAGCCTGCAGGCTTTGG + Intergenic
1086991036 11:93303945-93303967 CTGTTCCAGCCTGCAGGCTTTGG + Intergenic
1087199609 11:95332445-95332467 CAGTGGGAGCATGTAGGGTTAGG + Intergenic
1087606518 11:100384297-100384319 CCATTCCAGCCTGCAGGCTTTGG + Intergenic
1087626674 11:100603827-100603849 CTGTTGCAGCCTGCAGGCTTTGG + Intergenic
1087728779 11:101754841-101754863 CAGAGTCAGCTTGCAGGGTTGGG + Intronic
1088800962 11:113306789-113306811 CAGCTCCAGCATCCATGGTGAGG + Intergenic
1089486183 11:118847912-118847934 CAGTTCCAGAATGCACAGGTGGG + Intergenic
1089613792 11:119684161-119684183 CAGTTCCAGCCTGCTTGGCTAGG - Intronic
1090321624 11:125849752-125849774 AAGTGACAGCATGCAGTGTTTGG - Intergenic
1090633153 11:128668445-128668467 CAGCTCCAGCATGTAAGGTTTGG - Intergenic
1091146315 11:133283262-133283284 CAGATCCTGCATGAATGGTTTGG + Intronic
1097144834 12:56933027-56933049 CACTTCCAGCACACAGGGTGTGG - Intronic
1099052041 12:77792095-77792117 CAGTTGCAGCATACAGAGTGAGG - Intergenic
1099369463 12:81811959-81811981 CAGTTCCAGCCTGCATGCTTTGG + Intergenic
1101474657 12:105033188-105033210 TATTCCCAGCATGCAGTGTTTGG + Intronic
1110570638 13:76999280-76999302 CAGTGACAGGATGCAGTGTTTGG + Intronic
1110705645 13:78600804-78600826 CAGTTCGTGCGTGTAGGGTTGGG + Exonic
1111235309 13:85401017-85401039 TAGTTCCAGCCTGCAAGCTTTGG - Intergenic
1113665325 13:112137050-112137072 CAGCTCCAGCATGCTGAGCTAGG + Intergenic
1115239177 14:31237752-31237774 CAGTTTCAGCCTGCATGGTTAGG + Intergenic
1115344546 14:32328389-32328411 CAGTTCCAGCTTTTGGGGTTGGG + Intergenic
1115967807 14:38911887-38911909 CAGTTCCAGCTTTCGGGCTTTGG + Intergenic
1116493741 14:45536459-45536481 CCGTTTCAGCCTGCAGGCTTTGG - Intergenic
1118548291 14:66919477-66919499 CAGTTCAAGAATGAGGGGTTGGG + Intronic
1119664759 14:76477396-76477418 CAGTTCCAGTAGGCTGGGTGAGG - Intronic
1120910179 14:89659224-89659246 CCGTGGCAGCATGCAGGGTACGG - Intergenic
1124923483 15:34048348-34048370 CTGTTCCAGCCTGCTGGCTTTGG + Intronic
1126566929 15:50111056-50111078 CAGTTCCAGCATGGAGGTCTTGG - Intronic
1127683378 15:61318536-61318558 CAGCTCCAGCTGTCAGGGTTGGG + Intergenic
1129653707 15:77508930-77508952 CAGCTCCTCCCTGCAGGGTTGGG - Intergenic
1129685994 15:77686410-77686432 CAATACCAGCATGCAGGCCTGGG + Intronic
1130185502 15:81677512-81677534 CTGTTCCAGCCTCCAGGCTTTGG + Intergenic
1130629918 15:85556766-85556788 AAGAGCCAGCATGCAGAGTTAGG - Intronic
1132364124 15:101243685-101243707 CACTCCCAGCATGCATGGCTTGG + Intronic
1132722548 16:1323857-1323879 CTGTTCCACCATGCAGAGTGAGG + Intronic
1132976272 16:2712633-2712655 CAGTTCCAGCCAGCGAGGTTGGG - Exonic
1134015212 16:10883361-10883383 CCTGTCCAGAATGCAGGGTTGGG - Intronic
1134232571 16:12439988-12440010 CAATTCCAGGAGGCAGAGTTGGG - Intronic
1135690924 16:24537048-24537070 CAGTTCCAGCAAGCGGAATTGGG - Intergenic
1135916329 16:26608539-26608561 CAGTTCCTGGATTCAGGGGTTGG - Intergenic
1136134879 16:28249654-28249676 CAGCTGCAGCATGCAGGGGAGGG + Intergenic
1137555737 16:49469224-49469246 CAGATCTAGCATGCAGTGTGAGG - Intergenic
1140532179 16:75676176-75676198 CAGTTGAAGCATGCTGGGTTAGG - Intronic
1142168292 16:88605402-88605424 CAGGTCGACCATGCTGGGTTGGG + Intronic
1146503071 17:33381031-33381053 CAGTTCGAGATGGCAGGGTTTGG + Intronic
1148795887 17:50196450-50196472 CAGTTCCAGAGGGCAGGGATGGG - Intronic
1149223492 17:54441642-54441664 TAGTGACAGCATGCAGTGTTTGG - Intergenic
1150324426 17:64244855-64244877 CAGGTCCAGCAGCCAGGGTTGGG - Intronic
1151887712 17:76932878-76932900 CATTTCCAGCATGCAGGGCTGGG - Intronic
1152350021 17:79778980-79779002 CAGGTCCAGCATGCAGGGAGGGG - Intronic
1152377884 17:79928081-79928103 CAGGTCTGGCAGGCAGGGTTAGG + Intergenic
1152581417 17:81166928-81166950 AAGTGCCACCTTGCAGGGTTGGG + Intergenic
1152922456 17:83072853-83072875 ACGTTGCAGCAGGCAGGGTTGGG + Intergenic
1154447483 18:14447318-14447340 CACTTCCAGCAGGAGGGGTTGGG + Intergenic
1155464599 18:26120747-26120769 CTATTCCAGCCTGCAGGATTTGG + Intergenic
1158548274 18:58414155-58414177 CAATTCCAAAAGGCAGGGTTTGG + Intergenic
1161722172 19:5909107-5909129 CACCTCCAGCCTGCAGTGTTTGG + Exonic
1164418953 19:28070706-28070728 CAGTTTCAGGTTGCAGGGCTTGG - Intergenic
1164533815 19:29069192-29069214 CAGGTTCAGCATGCAGAGCTTGG + Intergenic
1165955534 19:39499681-39499703 GGGTCCCAGCATCCAGGGTTGGG - Intronic
1166588217 19:43969823-43969845 CTGTTCCAGCCTGCTGGCTTTGG + Intronic
1166824485 19:45600640-45600662 CAGTGCCAGGCTGGAGGGTTGGG - Intronic
1167829421 19:52007563-52007585 CTGTTCCAGCAGCCAGGGCTGGG + Intronic
925980541 2:9173615-9173637 GACTTCTAGCATGCAGGCTTGGG - Intergenic
926988173 2:18646836-18646858 CAGTTCCATCAAGCAGGGCAGGG + Intergenic
927337444 2:21941467-21941489 CAGTATCAGCAGGCAGGGTGTGG - Intergenic
929809113 2:45173753-45173775 CATTTCCAGCCTGCAGTGATGGG - Intergenic
929835747 2:45396789-45396811 CATTTCCAGCATGGAGATTTAGG + Intronic
932559869 2:72857638-72857660 CAGATCCAGAATGCTGGGCTGGG + Intergenic
936861975 2:117029744-117029766 CCATTCCAGCGTGCAGGCTTCGG + Intergenic
937873388 2:126802472-126802494 CGGGTGCAGCATGCAGGGCTTGG - Intergenic
938789420 2:134663697-134663719 CAATGCCATCTTGCAGGGTTGGG - Intronic
940368613 2:152876452-152876474 CAGTTCCACAATCCAGGGTTAGG + Intergenic
943477389 2:188375283-188375305 CAGTTGCAGGATGCAGCGGTCGG - Intronic
943768708 2:191692015-191692037 CCGTGACAGCATGTAGGGTTGGG + Intronic
943816702 2:192266760-192266782 CTGTCCCAGCATCCAGGGTATGG - Intergenic
1169840079 20:9926212-9926234 CAGTTCCATTAGCCAGGGTTGGG + Intergenic
1170508627 20:17054727-17054749 CAGTTCCAGTTTTCAGGGTTTGG - Intergenic
1170712830 20:18807735-18807757 TAATTCCAGCATGCAGAGATGGG - Intergenic
1171386675 20:24774157-24774179 CACCACCACCATGCAGGGTTTGG - Intergenic
1174201077 20:48806858-48806880 CAGTGCCAGTATGGAGGGCTGGG + Intronic
1176276115 20:64270358-64270380 GAGTTCAGGCATGCAGGGTGTGG + Intronic
1178575172 21:33781339-33781361 CAGCTTCACCATGCAGGATTTGG + Intronic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1180399362 22:12394743-12394765 GAGTGACAGCATGCAGTGTTTGG - Intergenic
950156202 3:10723443-10723465 CATTTCCTGCACGCAGGGTGGGG + Intergenic
950587456 3:13904641-13904663 CTGTTCCAGCCTGCTGGCTTTGG + Intergenic
950689957 3:14647669-14647691 CAGTTCTAGCTTGCATGGTCAGG + Intergenic
951605518 3:24429875-24429897 AAATTACAGGATGCAGGGTTTGG + Intronic
951921241 3:27856603-27856625 CATCTCCAGGATGCAAGGTTAGG + Intergenic
952460564 3:33521030-33521052 CAGTACCAGAATGCAAGGATGGG + Intronic
957328746 3:78731360-78731382 GAGTTCCAGCATTTAGGGATGGG + Intronic
958112177 3:89162713-89162735 CAGTTCCAGCATGCAGGGTTGGG - Intronic
958466815 3:94469973-94469995 CAGTTCCAGGCTTCAGGGTGGGG + Intergenic
959032108 3:101311022-101311044 CATTTCCAGCATGAAGAGTGAGG + Intronic
959090749 3:101900093-101900115 CAGTTTCAGCATTAAGGGTGAGG + Intergenic
960511250 3:118552233-118552255 CCGTTTCAGCCTGAAGGGTTAGG + Intergenic
960685123 3:120287586-120287608 CTGTTCCAGCCTTCAGGGTTTGG + Intergenic
961319967 3:126065989-126066011 CAGTACCAGGAGGCAGGGTCGGG - Intronic
961331659 3:126146199-126146221 CAGGTCCAGCTTCCAGGGTTGGG - Intronic
962327256 3:134446553-134446575 CACTGCCAGCATGGAGGGTTAGG + Intergenic
962387293 3:134942247-134942269 CAGTCCCAGCCTGTAGGATTGGG + Intronic
963056983 3:141193934-141193956 CCGTTCCAGCCTGCAGTCTTTGG + Intergenic
966454818 3:180102657-180102679 CTGTTCCAGCCTGCAGGCTTTGG + Intergenic
966853226 3:184177114-184177136 CAGCCCCAGCATACAGGATTAGG + Intronic
968381655 4:101654-101676 TCGTTCCAGCCTGCAGGCTTTGG - Intergenic
968437234 4:600069-600091 CCGTTCCAGCCTGCAGACTTTGG - Intergenic
970062619 4:12051732-12051754 CAGTGAGAGCATGCAGCGTTTGG - Intergenic
971268303 4:25113878-25113900 GAGTTCCAGCAGGCATGGTTAGG + Intergenic
971739087 4:30497748-30497770 CAGTTCCAGCTGACAGGGTATGG + Intergenic
978400628 4:108326575-108326597 CAGTGCCAGCTTGCAGGATGGGG + Intergenic
978483780 4:109226594-109226616 GAGTTTCAGCATTCAGGATTTGG - Intronic
978982760 4:114969549-114969571 AAGTGCCAACATGCAGTGTTTGG + Intronic
979790049 4:124768348-124768370 CAGATCCCTCATGAAGGGTTTGG - Intergenic
980486343 4:133461935-133461957 CAGTTCCAGAAGGCAGCATTAGG + Intergenic
980628816 4:135408223-135408245 CAGCTCCAGCACGCTGGGCTTGG - Intergenic
980905489 4:138944589-138944611 TGGTTCCAGCATGGAGGATTGGG - Intergenic
985345742 4:189002295-189002317 CTGTTCCAGCCTGCTGGCTTTGG - Intergenic
985492128 5:186274-186296 GATTTCCAGAAGGCAGGGTTAGG + Exonic
988128361 5:27072910-27072932 CTGTTCCAGCCTTCAGGCTTTGG + Intronic
991143487 5:63273937-63273959 CTATTCCAGCCTGCAGGCTTTGG - Intergenic
991932430 5:71766666-71766688 CAGGTCCTGCAAGCAGGCTTGGG + Intergenic
992133214 5:73716283-73716305 CCATGCCAGCATGAAGGGTTTGG + Intronic
993385333 5:87255617-87255639 CAGATCTAGCATGCAGAGTGGGG - Intergenic
993792359 5:92223296-92223318 CTGTTCCAGCATGTGGGCTTTGG - Intergenic
995329707 5:110933536-110933558 CTCTTCCAGCCTGCAGGCTTTGG - Intergenic
999117383 5:149175780-149175802 CAGCTACAGCATAAAGGGTTTGG - Intronic
999621601 5:153480129-153480151 CACTTCCAGCCTGCAGGATGAGG - Intergenic
1002074024 5:176697539-176697561 CAGCTCCATCCTGCAGGGCTGGG + Intergenic
1003323226 6:5071428-5071450 CACCTCCAGCAAGCAGGGCTGGG + Intergenic
1004641165 6:17516714-17516736 GACATCCAGCATGGAGGGTTGGG - Intronic
1005497552 6:26401520-26401542 CACCTCCAGCATCCAGGCTTAGG - Intergenic
1007958745 6:45940047-45940069 CAGTGCCAGCTTGGAGGGCTTGG - Intronic
1008686711 6:53933234-53933256 CAGTTCCACCATGCTGTGTATGG - Intronic
1010088607 6:71952053-71952075 CAGTTCCATCATGCATGGGCAGG + Intronic
1011305188 6:85917789-85917811 CAGTTCCAGAATGCAGAGTTAGG + Intergenic
1011370786 6:86634429-86634451 CTGTTCCAGCTTGCAGGCTTTGG - Intergenic
1013188420 6:107782143-107782165 CCATTCCAGCCTGCAGGATTCGG + Intronic
1015112981 6:129614920-129614942 AAGTTTCAGCCTGCAGAGTTTGG + Intronic
1015199771 6:130565972-130565994 TAGGTTCAGCATGCAGGTTTTGG - Intergenic
1016569663 6:145497884-145497906 CTGTTCCAGCCTGCCGGCTTTGG - Intergenic
1020748556 7:12110900-12110922 CAGTTTCAGCATGCTGGAGTAGG - Intergenic
1022096080 7:27142500-27142522 CGTTTCCAGCCTGCAGGGTTGGG + Intronic
1022601405 7:31763532-31763554 CTGTTCTAGCACTCAGGGTTTGG + Intronic
1024597022 7:50946962-50946984 CAGCTCCAGCCTGAGGGGTTAGG - Intergenic
1024814413 7:53251687-53251709 CAGTTACAGAATGAAGGGTAAGG - Intergenic
1026501667 7:70947917-70947939 CAGTGACATCATGTAGGGTTGGG + Intergenic
1031223239 7:119000135-119000157 CAGCTCCAGCCTTCAAGGTTAGG + Intergenic
1035370419 7:158376240-158376262 CACGTCCTGCATGCAGGGTCAGG + Intronic
1036294793 8:7527153-7527175 CAGTTTCAGCCTGCATGGTATGG + Intergenic
1036296429 8:7541736-7541758 CAGTTTCAGCCTGCATGGTATGG + Exonic
1036326137 8:7779283-7779305 CAGTTTCAGCCTGCATGGTATGG - Exonic
1036327770 8:7793838-7793860 CAGTTTCAGCCTGCATGGTATGG - Intergenic
1037998203 8:23368570-23368592 CATTTCCACCATGCAGGGCTGGG + Intronic
1040092088 8:43408950-43408972 CTGTTCCAGCCAGCAGGATTTGG - Intergenic
1040400543 8:47045462-47045484 CTGTTCCAGCCTGCAGGCTGTGG + Intergenic
1041623424 8:59999365-59999387 CTGTTCCAGCCTGCAGGCTTTGG + Intergenic
1041978655 8:63829539-63829561 CATATCCAGCATGCATGTTTTGG + Intergenic
1042489515 8:69381498-69381520 CTGTTCCAGCCTGCGGGCTTTGG + Intergenic
1043363192 8:79499678-79499700 CTGTTCCAGCCTGCTGGCTTGGG - Intergenic
1043381549 8:79707678-79707700 GAGTTCTAGTATTCAGGGTTGGG + Intergenic
1044125760 8:88456876-88456898 CAATTCCAGCCTTCAGGCTTTGG + Intergenic
1044450991 8:92335714-92335736 CTGTTCCAGCCTGCAGGTTTTGG - Intergenic
1044451036 8:92335979-92336001 CAGTTCCAGCTTGTGGGCTTTGG - Intergenic
1045561505 8:103268353-103268375 CAATTCTAGCATGCAGTATTAGG - Intergenic
1050415358 9:5410591-5410613 CAGTTTAAGCAGGCAGGGTTGGG + Intronic
1050529993 9:6580430-6580452 AAGTTCTGGCATGCAGGGTCTGG - Intronic
1055298757 9:74861265-74861287 AAGTCCCAGCATGCAGCGTGGGG - Intronic
1056299558 9:85227229-85227251 CAGTTCCAGCATCCAGCCATGGG - Intergenic
1057192068 9:93093916-93093938 CAGTCCCTGCATGCAGGCTTGGG + Intergenic
1057234054 9:93345048-93345070 AAGTTACAGCATGCAGTATTTGG + Intronic
1058685111 9:107473378-107473400 CAGATTCAGCATGAAGGTTTTGG - Intergenic
1059320181 9:113463217-113463239 GTGATCCAGGATGCAGGGTTTGG + Intronic
1061138778 9:128751872-128751894 CAGTTACAGCTGGTAGGGTTTGG + Intronic
1061486422 9:130922742-130922764 CAGCCCCAGGCTGCAGGGTTGGG - Intronic
1062040112 9:134400661-134400683 CAGTGCCAGCCTCCAGGGTGCGG + Intronic
1188254822 X:27948830-27948852 CAGTGACAACATGCAGTGTTTGG + Intergenic
1188901143 X:35734124-35734146 CAGTTCCAGTCTGCGGGGTTTGG - Intergenic
1188954145 X:36414359-36414381 CAGTTCCACTATGCAGAGTCTGG - Intergenic
1189297695 X:39930345-39930367 CAGAGCCAGCAGGCAGGGTAGGG - Intergenic
1190803513 X:53813884-53813906 CCATTCCAGCCTGCAGGCTTTGG - Intergenic
1190977148 X:55416751-55416773 CCATTCCAGCCTGCAGGCTTTGG + Intergenic
1191022608 X:55878591-55878613 CTGTTCCAGCCTGCTGGTTTTGG + Intergenic
1191209645 X:57871640-57871662 CAGTTCCAGCCTGTGGGCTTTGG - Intergenic
1191209693 X:57871908-57871930 CTGTTCCAGCCTGCGGGCTTTGG - Intergenic
1191877007 X:65807452-65807474 CCGTTCCAGCTTTCAGGTTTTGG + Intergenic
1191930309 X:66365070-66365092 CTGTTCCAGCCTGCGGGATTTGG - Intergenic
1191930354 X:66365333-66365355 CTGTTCCAGTCTGCAGGCTTTGG - Intergenic
1191960601 X:66697274-66697296 CACTTCCAGCCTACATGGTTGGG - Intergenic
1193051980 X:77111471-77111493 CAATTCCAACCTGCAGGCTTTGG + Intergenic
1193712314 X:84894481-84894503 CCATTCCAGCCTGCAGGTTTTGG - Intergenic
1194188640 X:90807680-90807702 CAGTTCCAACCTTCAGGATTTGG - Intergenic
1194830579 X:98618751-98618773 CCATTCCAGCCTGCAGGCTTTGG - Intergenic
1194914246 X:99685416-99685438 CCATGCCAGCATGCAGGCTTAGG + Intergenic
1195361265 X:104085526-104085548 CAGTTCCAGCCTTAAGGCTTTGG - Intergenic
1196303974 X:114079085-114079107 GAGTGACAGCATGCAGTGTTTGG + Intergenic
1196582032 X:117390986-117391008 CTGTTCCAGCCTTCAGGATTTGG + Intergenic
1197122168 X:122906017-122906039 CTGTTCCAGCCTTCAGGCTTTGG + Intergenic
1197573433 X:128178243-128178265 CTGCTCCAGCCTGCTGGGTTTGG + Intergenic
1198332779 X:135637074-135637096 CAGTTTCAGAATGCATAGTTGGG + Intergenic
1198365303 X:135933933-135933955 CAGTTTCAGAATGCATAGTTGGG + Intergenic
1198417629 X:136436400-136436422 CAGTACCAGAGTGCAGGGCTGGG - Intergenic
1198705419 X:139443404-139443426 CAATTCCAGCCTGCAGGCTTTGG + Intergenic
1199338496 X:146647635-146647657 CTGATCCAGCATGGAGGGGTTGG + Intergenic
1200344557 X:155435620-155435642 CTGTTCCAGCCTGCAGGCTTTGG + Intergenic
1200344607 X:155435868-155435890 CCGTTCCAGCCTGCAAGCTTTGG + Intergenic
1200535224 Y:4389575-4389597 CAGTTCCAACCTTCAGGATTTGG - Intergenic
1201967644 Y:19755192-19755214 CTGTTCCAGCCTGCAGGTTTAGG - Intergenic