ID: 958112421

View in Genome Browser
Species Human (GRCh38)
Location 3:89165769-89165791
Sequence GTTCAGGCCTTGAATGATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958112417_958112421 -3 Left 958112417 3:89165749-89165771 CCTGACTCCTTTCCAAGGCTGTT 0: 1
1: 0
2: 1
3: 28
4: 322
Right 958112421 3:89165769-89165791 GTTCAGGCCTTGAATGATAAAGG 0: 1
1: 0
2: 1
3: 5
4: 124
958112419_958112421 -10 Left 958112419 3:89165756-89165778 CCTTTCCAAGGCTGTTCAGGCCT 0: 1
1: 0
2: 2
3: 13
4: 143
Right 958112421 3:89165769-89165791 GTTCAGGCCTTGAATGATAAAGG 0: 1
1: 0
2: 1
3: 5
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958112421 Original CRISPR GTTCAGGCCTTGAATGATAA AGG Intronic
906041772 1:42793345-42793367 GTCCAAGCCTTGCATGTTAAGGG + Intronic
908872748 1:68633265-68633287 GTATAGGACTTGAAAGATAAAGG - Intergenic
911002831 1:93184008-93184030 TTTCAGACCTTGAAGGATTAGGG - Exonic
914701101 1:150134946-150134968 GTTCCTGCCTTGAATAGTAAAGG - Intronic
914930128 1:151923473-151923495 TTTCAAGGCTTGCATGATAAAGG + Intergenic
916617540 1:166458092-166458114 CTTCAGGCCTTGAATAATGTTGG - Intergenic
918286112 1:183056467-183056489 GGTCAGGCCTTGAAAGACAGTGG - Intronic
922093552 1:222421258-222421280 GTTCAGGCTTTGAATCAAGATGG - Intergenic
922338837 1:224639316-224639338 CTTCAGGCCTTGAAGGAGATTGG + Intronic
1068164133 10:53305899-53305921 GTTCAGGCCATGAAGGAAAGTGG + Intergenic
1070905900 10:80072932-80072954 GTTCAGGCCATGACTGAAAGTGG - Intergenic
1073948125 10:108776040-108776062 CTGCAGGCATTGAATGAGAAAGG - Intergenic
1076901874 10:133343349-133343371 GATCAGGTCTGGAATGAGAAAGG - Intronic
1077885067 11:6381391-6381413 GTTCAGGCCATGATTGAAAGTGG + Intergenic
1077970768 11:7187682-7187704 GCTCAGACCTTGAAGGAGAAGGG + Intergenic
1078403337 11:11046658-11046680 GTTCAGGCCATGAACGAAAGTGG - Intergenic
1080422407 11:32122475-32122497 GTTCAGAAATTGAATGTTAAAGG + Intergenic
1080650943 11:34222360-34222382 GTTCAGGCCATGAATGGAAGTGG - Intronic
1090662960 11:128894953-128894975 GCTCTGGCCTGGAACGATAATGG - Intronic
1096389193 12:51216593-51216615 GACCAGGACTTGAATGAAAATGG + Intronic
1096648623 12:53051138-53051160 ATTCACGCATTGAATGAGAAAGG - Intronic
1097386271 12:58953139-58953161 TTTCAGGACCTGATTGATAATGG - Intergenic
1098626459 12:72677111-72677133 GTTCTGGCCTAGAGTGTTAAGGG + Intergenic
1099468746 12:83020235-83020257 GTTGAGCCCTAGAATGAAAATGG - Intronic
1100082384 12:90868777-90868799 GGGCAGGCTTTGGATGATAAGGG - Intergenic
1102067533 12:109989777-109989799 GTTGAGACCTTGTATAATAACGG - Exonic
1104425470 12:128673520-128673542 CTTCAGGCCCAGTATGATAAAGG - Intronic
1107852752 13:44587468-44587490 GTTCAGGCCATGAAAGAAGAAGG - Intergenic
1107882348 13:44843658-44843680 GTTCATGCCCTGATTGGTAAAGG - Intergenic
1108088978 13:46825689-46825711 ATTCAGGCCTTTGATGAAAATGG + Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1114773969 14:25460545-25460567 GTTCAGGCCTTGATAGAAGAGGG + Intergenic
1127940256 15:63688140-63688162 GTTCAGGCCAGAGATGATAATGG + Intronic
1129153924 15:73705775-73705797 GAGAAGGCCTTGAAGGATAAGGG + Intronic
1129343928 15:74904845-74904867 GAACAGGCCTTGAATAATACTGG + Intronic
1129607843 15:77033479-77033501 GTTCAGGCCTTGAGTGACGAAGG + Intronic
1133322058 16:4920398-4920420 GTTCAGTCCTTGAACCACAAAGG - Intronic
1139417601 16:66826953-66826975 GTTGATGCCTTGAATGGTTAGGG + Intronic
1140251254 16:73296269-73296291 GCTAAGACCTTGTATGATAATGG + Intergenic
1141058476 16:80841264-80841286 GTTCTAGACTTGATTGATAAAGG + Intergenic
1142770239 17:2091476-2091498 GTGCAGGGGCTGAATGATAAGGG + Intronic
1147774255 17:42889444-42889466 ATTCAGACCTTGCATCATAATGG - Intergenic
1151097313 17:71513316-71513338 GTTCATATCTTGAATGAGAAAGG + Intergenic
1167202785 19:48078168-48078190 GTTGAGGGCTTTAATCATAAAGG - Intronic
926253147 2:11167591-11167613 GTTCAGCCCTTGCATGATAAAGG - Intronic
929455517 2:42062078-42062100 GTTGGGGCCTTGAATGATAGAGG - Intergenic
931697056 2:64879282-64879304 CTTCAGGCATTGTATGATTAAGG - Intergenic
933527798 2:83465614-83465636 GTTCAGGCCATGATGGAAAATGG + Intergenic
938914446 2:135921664-135921686 GATCATGCTTTGAGTGATAAGGG - Intronic
942385138 2:175434759-175434781 TTTCAGATCTTGAATGATAATGG - Intergenic
944297874 2:198087880-198087902 GTTCTGCACATGAATGATAATGG - Intronic
1169289314 20:4335162-4335184 GTTAAGGCCTTGGCTGAGAAGGG - Intergenic
1169722183 20:8690567-8690589 TTTCAGGCCTTGAATTCTCATGG - Intronic
1169824323 20:9750119-9750141 GTTTAGGCCATAAATGAAAAAGG - Intronic
1171576418 20:26327234-26327256 TTTCAGGCCTTTAGTGAAAAAGG + Intergenic
1175002542 20:55644826-55644848 GTTAAGACTTTGAATGACAAAGG - Intergenic
1178244546 21:30937935-30937957 GTTCATGCCATGAATGATTCCGG + Intergenic
1183051458 22:35265231-35265253 GTTCAAGCCCTGAAAGATCAAGG - Exonic
1183166790 22:36154173-36154195 GTTCAGGCCATGAAGGGAAATGG - Intronic
1184107496 22:42376712-42376734 TCTCAGGCCCTGAATGATCAGGG + Intergenic
949121923 3:395606-395628 GTTCAGGCATGGAAGGATATTGG + Intronic
950386017 3:12661059-12661081 GCTTAGCCCTTGAGTGATAAGGG + Intronic
951857449 3:27213605-27213627 GTTCAGGCCGTGATAGGTAAGGG + Intronic
952979927 3:38726539-38726561 CTTCAGGGCTTGAGTGACAAAGG - Intronic
956969965 3:74511410-74511432 CTTTATGCCTTGAAGGATAAAGG - Intronic
958112421 3:89165769-89165791 GTTCAGGCCTTGAATGATAAAGG + Intronic
962234145 3:133693410-133693432 TTTCAGCCCTTGAATAATGATGG + Intergenic
963933932 3:151033633-151033655 GTTGTGGCCTTGAATGGGAAGGG - Intergenic
966153344 3:176890361-176890383 GTTGAGGGCTTTAATCATAAAGG - Intergenic
967127063 3:186433979-186434001 CTTCAGCCCTGGAAGGATAAAGG + Intergenic
973993990 4:56438120-56438142 ATTCAGGATTTGAATGAAAAGGG - Intronic
975814634 4:78205088-78205110 GTTGAGTCCATAAATGATAAGGG + Intronic
975827228 4:78332397-78332419 CATCAGACCTTTAATGATAAAGG - Intronic
981177402 4:141698026-141698048 GTTCAGGGTTTTAATTATAAAGG + Intronic
981568422 4:146125792-146125814 CTTACAGCCTTGAATGATAAAGG - Intergenic
986764864 5:10916147-10916169 TTTCTGGCCTTGAAGGATGAAGG - Intergenic
987759163 5:22136849-22136871 TTTCAGGTCTTAAATGATATAGG - Intronic
988359772 5:30220987-30221009 GTTATGGCCTTGATTCATAATGG + Intergenic
989833256 5:45948130-45948152 ATTGAGGCCTTTGATGATAAAGG + Intergenic
989915006 5:49713833-49713855 GTTGAGGCCTTCAATGGAAACGG + Intergenic
993179225 5:84528404-84528426 GTTGAGGCCATGAATGAAATTGG - Intergenic
993700983 5:91119077-91119099 GTTGAGTCCTTGTATGCTAAAGG - Intronic
995239167 5:109866229-109866251 ATTAAGGCCTTGAGTCATAAGGG + Intronic
996077426 5:119213341-119213363 GTTCTGGCCTTGAACAAAAAGGG - Intronic
996523553 5:124452911-124452933 CTTCAGGCCTGGGATAATAATGG + Intergenic
998512810 5:142727850-142727872 TTCCTGGCCTTGAAAGATAAGGG + Intergenic
1000119963 5:158188150-158188172 GTTCACTCCTTGAAAGATCAAGG + Intergenic
1003142992 6:3487185-3487207 GTGCAGGCCTGGAATGGGAAAGG - Intergenic
1009255988 6:61399935-61399957 TTTCAGGCCTTCATTGAAAACGG + Intergenic
1009405823 6:63311372-63311394 GTTCATGCCTTGATTGAAGACGG - Intronic
1010126361 6:72436867-72436889 AATCAGGCCTTGAATGAGACAGG - Intergenic
1011676856 6:89743210-89743232 GTTCAGGCCATGAAGGAGGACGG - Exonic
1012077147 6:94703741-94703763 GTTCAGGCCTTCAGTGAATAGGG + Intergenic
1012376609 6:98569479-98569501 GTTTAAGCCTTGATAGATAATGG - Intergenic
1017177214 6:151516294-151516316 GTTCAAGCCTTGATGGAAAATGG - Intronic
1017829905 6:158116734-158116756 TGTCAGGCCTTGGATGAAAAAGG - Intronic
1019069241 6:169328449-169328471 GTAGAGGCCTTGAATTAAAAAGG + Intergenic
1020194605 7:6027238-6027260 GGTCAGGCCTGGATTGTTAAGGG - Intronic
1020680814 7:11234426-11234448 GTTCAGGCCATGATGGAGAAGGG - Intergenic
1021731441 7:23598925-23598947 GCTCAGACTTTCAATGATAAAGG + Intronic
1022810682 7:33864849-33864871 GTTCAGGGAATGAATGGTAAGGG - Intergenic
1023925042 7:44662407-44662429 TTTCAGGACCTGAAAGATAAGGG - Intronic
1028507111 7:91582808-91582830 CTTCAGGCCTAGGATGAGAAGGG - Intergenic
1030135846 7:106247172-106247194 GTATTGGCCTTGAATGATAGGGG - Intergenic
1030322398 7:108182742-108182764 GTTCAGGCCCTGAATGACATGGG - Exonic
1030601875 7:111602226-111602248 GTTCAGACTTTTAATGAGAATGG + Intergenic
1036660171 8:10702663-10702685 GTTTAGGCCTTGCATGAGTAGGG - Intronic
1037879928 8:22567692-22567714 GTTCTGGGCTTGACAGATAAAGG + Intronic
1038699421 8:29835934-29835956 GTTAAGGTCATGAATGACAAAGG - Intergenic
1039972758 8:42334373-42334395 TTGCAGGCCTTGAATCCTAATGG - Intergenic
1041463230 8:58133966-58133988 TTTCAAGCCTAGAATGTTAAAGG - Intronic
1042097869 8:65238241-65238263 GAGTAGGCCTTGAATGTTAATGG + Intergenic
1042470169 8:69178442-69178464 GTTCAGGTATAGAATGATTAGGG + Intergenic
1043119335 8:76302904-76302926 GTTCAGGCCATGATTGGTACTGG + Intergenic
1043811109 8:84741889-84741911 GTCCAAACCTTGAATGTTAATGG - Intronic
1044778485 8:95719373-95719395 GTTCAGCCCTTGAAATATAAGGG - Intergenic
1045141646 8:99291738-99291760 ATTTAAGCCTTGAGTGATAAAGG + Intronic
1047816301 8:128467260-128467282 GTTCAGACTTCAAATGATAAAGG - Intergenic
1051013179 9:12443935-12443957 GCTCTGGCTTAGAATGATAAAGG + Intergenic
1051931587 9:22392769-22392791 GTTTAAGCCTTAAATGAGAAAGG - Intergenic
1055467910 9:76583572-76583594 TTTCAGGCCTTGAAATCTAATGG - Intergenic
1058744802 9:107979987-107980009 GTTCAGGACTAGGATGATAGTGG + Intergenic
1186450522 X:9669639-9669661 TTTCAGGGCTTGCATGACAAAGG - Intronic
1187262007 X:17693631-17693653 GATAAGACCTTGAGTGATAATGG + Intronic
1188173218 X:26954751-26954773 GTTCAGTTCTTACATGATAATGG - Intergenic
1190898529 X:54645694-54645716 CTTCAGTCCTTGAATGGTCAGGG - Intergenic
1191919646 X:66241259-66241281 GTATTGGCCTTGAATGAAAATGG + Intronic
1194707209 X:97190225-97190247 GTGCATTCCTTGAATGATAGAGG + Intronic
1195195509 X:102494143-102494165 ATTCAGGCTTTTAATGAAAAAGG + Intergenic
1200925701 Y:8652658-8652680 TTTCAGACCTTGTATGAGAAAGG + Intergenic
1201888689 Y:18917455-18917477 GTTCAGGCCATGATGGATGAGGG + Intergenic