ID: 958114345

View in Genome Browser
Species Human (GRCh38)
Location 3:89196026-89196048
Sequence AATGACTGGGAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 926
Summary {0: 1, 1: 0, 2: 4, 3: 74, 4: 847}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958114345_958114354 26 Left 958114345 3:89196026-89196048 CCTTCCTCCTTCTCCCAGTCATT 0: 1
1: 0
2: 4
3: 74
4: 847
Right 958114354 3:89196075-89196097 TACAAGATACTGTCTACCTTGGG 0: 1
1: 0
2: 1
3: 6
4: 128
958114345_958114353 25 Left 958114345 3:89196026-89196048 CCTTCCTCCTTCTCCCAGTCATT 0: 1
1: 0
2: 4
3: 74
4: 847
Right 958114353 3:89196074-89196096 ATACAAGATACTGTCTACCTTGG 0: 1
1: 0
2: 1
3: 8
4: 148
958114345_958114350 0 Left 958114345 3:89196026-89196048 CCTTCCTCCTTCTCCCAGTCATT 0: 1
1: 0
2: 4
3: 74
4: 847
Right 958114350 3:89196049-89196071 CTCTTTACCTCTCTCCTCTGAGG 0: 1
1: 0
2: 2
3: 50
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958114345 Original CRISPR AATGACTGGGAGAAGGAGGA AGG (reversed) Intronic
900129188 1:1080422-1080444 ACTGGGTGGGAGGAGGAGGAGGG + Intergenic
900296771 1:1955888-1955910 GCTGACTGGGAAAAGGAGGTGGG - Intronic
900498788 1:2989562-2989584 AATGGATGGAAGATGGAGGATGG - Intergenic
900892300 1:5458339-5458361 AAGGAGGGAGAGAAGGAGGAAGG - Intergenic
900918874 1:5658417-5658439 ATTTACTGGGAGAAGGAGGTGGG - Intergenic
900966230 1:5960632-5960654 CATGACAGGTAGAAGGAGGCTGG + Intronic
901025444 1:6276599-6276621 GGCGACTGGGAGTAGGAGGAGGG + Intronic
901361091 1:8701334-8701356 AATGCCTGAGAGAGGGAGGGAGG - Intronic
901661102 1:10798403-10798425 AATTATTGGGATAAGGAGGGGGG - Intergenic
901831484 1:11895016-11895038 CAAGGCTGGGAGAAGGAAGATGG - Intergenic
902090301 1:13897845-13897867 AAGGACCTGGAGAGGGAGGAAGG - Intergenic
902797639 1:18809788-18809810 ATTGACTGGGAGAACAAAGATGG - Intergenic
902832697 1:19028097-19028119 AAGGACTGTGAGAACAAGGATGG + Intergenic
903232021 1:21927700-21927722 CTGGACTGGGAGAAGGAGGGGGG - Intronic
903283611 1:22263906-22263928 AAGGACTCGGTGGAGGAGGATGG - Intergenic
903480879 1:23652451-23652473 AATGACTGGGAGGAGAAGTCCGG + Intergenic
904052425 1:27647768-27647790 CAGGGCCGGGAGAAGGAGGAGGG + Intergenic
904096038 1:27978154-27978176 AGTGACAGGGAGGAAGAGGAAGG + Intronic
904370848 1:30046512-30046534 TGTGACTGGGAGGAAGAGGATGG + Intergenic
905017348 1:34786741-34786763 AGTGACTGGGTGACAGAGGAGGG - Intronic
905254560 1:36671849-36671871 CATGACTGGTATAAGGAGGATGG - Intergenic
905741493 1:40374642-40374664 AATGACGAGGAGGAGGAGGAGGG + Intronic
905875229 1:41427908-41427930 AAGGAGTGAGAGGAGGAGGACGG - Intergenic
906132071 1:43466333-43466355 AATAACTGGGAGAAGGTGTGTGG - Intergenic
906182462 1:43833935-43833957 AATGCCTGTGAGAAGGCGGAGGG - Intronic
906286641 1:44592100-44592122 AAGGAATGAGAGAAGAAGGAAGG + Intronic
906291870 1:44624662-44624684 AAGGACAGGGAGAAGGAGGGAGG + Intronic
906658289 1:47564631-47564653 GGGGCCTGGGAGAAGGAGGAGGG - Intergenic
906674950 1:47686925-47686947 CAGGACTGGGACTAGGAGGATGG - Intergenic
907049802 1:51322222-51322244 GAGGCCTTGGAGAAGGAGGAGGG - Intronic
907307415 1:53521046-53521068 AAGGACTGAGAGAAGGAGGCAGG + Intronic
908353157 1:63306225-63306247 AATAAGGAGGAGAAGGAGGAAGG + Intergenic
908627088 1:66057592-66057614 AATCACTGGGGGAAGGTGAAAGG + Intronic
908703314 1:66924954-66924976 GACGACTGGAAGAAGGAGGCGGG + Exonic
909477351 1:76095739-76095761 AAAGACTGGGGGAAGGAGTGTGG + Intronic
910208593 1:84772274-84772296 ATTGACTGGGAGGAGGAGACTGG + Intergenic
910927700 1:92413287-92413309 ATAAGCTGGGAGAAGGAGGAGGG - Intergenic
910964445 1:92794171-92794193 AAGGAAGGAGAGAAGGAGGAAGG + Intergenic
911063067 1:93764367-93764389 AGAGACTGGGACATGGAGGAAGG - Intronic
911115890 1:94246866-94246888 CATGGCTGGGAAAAGGTGGAAGG + Intronic
911175162 1:94811175-94811197 AATAAGGGGGAGAAGGAGGGAGG - Intergenic
911215312 1:95186640-95186662 AATGAATGGCTGAAGGAGAAGGG + Intronic
911323566 1:96443181-96443203 AATGAGGAGGAGGAGGAGGAGGG - Intergenic
911436457 1:97865531-97865553 AATCAGAGGGTGAAGGAGGATGG - Intronic
911470310 1:98309998-98310020 AATGACTTGGAGAACTAGGATGG - Intergenic
911511861 1:98816792-98816814 ATTCACTGGGAGAAGGAGGTGGG + Intergenic
911953883 1:104211338-104211360 AATGACTGCGACAAAGAGAATGG - Intergenic
912259143 1:108092051-108092073 AAAGAGGAGGAGAAGGAGGAAGG - Intergenic
912273955 1:108237308-108237330 AATGACCATGAGGAGGAGGAGGG - Exonic
912287312 1:108382554-108382576 AATGACCATGAGGAGGAGGAGGG + Intronic
912294264 1:108457015-108457037 AATGACCATGAGGAGGAGGAGGG + Exonic
912532868 1:110339098-110339120 AATGAAAGGGATAAGGAGGTGGG + Exonic
912560555 1:110548428-110548450 AAGGACAGAGAGAAGGAGAAGGG + Intergenic
912725722 1:112057443-112057465 AGCGTCTTGGAGAAGGAGGATGG - Intergenic
913115605 1:115693540-115693562 AAAGACTGGGAGAAAGAGGAAGG - Exonic
913370355 1:118092314-118092336 AAGGATTGGGAGAGGGAGAATGG - Intronic
913490452 1:119374872-119374894 CCTGACTGAGGGAAGGAGGAAGG - Intronic
914339594 1:146748765-146748787 AATGACTTGGGCAAGGAGAAGGG + Intergenic
914739056 1:150447965-150447987 CAAAACTGGGAGAAGGAGAAAGG - Intronic
914902594 1:151719056-151719078 ACTGACTGGGAGGAGGAGTGAGG - Intronic
914925986 1:151888125-151888147 AGGGAGTGGGAGAAGCAGGACGG - Intronic
915066225 1:153226467-153226489 ATTGGATGGGAGAAGAAGGAAGG + Intergenic
915213912 1:154327972-154327994 AGAGACTGGGAGAAGGAGGCTGG + Intronic
915438256 1:155925764-155925786 AATGTCAAGGAGAAGGTGGAAGG - Exonic
915915403 1:159937635-159937657 AAGGACGGGGAGGAGGAGGATGG - Intronic
916229510 1:162526346-162526368 AGTTACTGGGTGAAGGAGTAGGG + Exonic
916379049 1:164188498-164188520 ACTGAATGGGAGAGGGAGGGAGG - Intergenic
916434096 1:164760444-164760466 AAAGAAGGAGAGAAGGAGGAAGG - Intronic
916506815 1:165435695-165435717 AATGACTAGGAGTGGGAGGCAGG + Intronic
916662378 1:166934637-166934659 ATTGACTGGAAGAAGGTAGAAGG - Intronic
916772345 1:167923532-167923554 AGGGACTGGGAGAAGGAGAATGG + Intronic
916893458 1:169136622-169136644 CATGAATGGCAGAAGAAGGAGGG - Intronic
917123794 1:171668014-171668036 CACGACTGGAAGAAGGAGGAAGG + Intergenic
917448247 1:175124807-175124829 AAGGAAGGGGAGAAGGAGGTAGG - Intronic
917509515 1:175658646-175658668 AATGACTGGAAGAAGAGAGAAGG - Intronic
917722930 1:177803318-177803340 ACTGACTGGGGCAAGGAGGTTGG - Intergenic
917823951 1:178796512-178796534 AATGACTGGAAGCAGGGAGAGGG - Intronic
918070806 1:181132120-181132142 ACTGCCTGGCAGATGGAGGAGGG + Intergenic
918703575 1:187635477-187635499 AGTGACAGGGAGAAAGAGGATGG - Intergenic
919031552 1:192249763-192249785 AATGACTTTGAGAAGGTGAAAGG - Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919744319 1:200999423-200999445 AGTGGCTGTGAGGAGGAGGAAGG - Exonic
919830630 1:201538419-201538441 AGTCCCTGGAAGAAGGAGGAGGG + Intergenic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920127397 1:203704250-203704272 AAGGACTGGAGGAAGAAGGAAGG + Intronic
920536682 1:206741936-206741958 ATTGACTGGGAGCACGAGAAAGG - Intergenic
920847513 1:209606445-209606467 TAAGTCTGGGAGCAGGAGGAAGG + Intronic
920924804 1:210330766-210330788 ATGGACTGGGGGAAGGGGGATGG + Intronic
921382539 1:214539655-214539677 AAGGAAGGGAAGAAGGAGGAGGG + Intronic
921409472 1:214819741-214819763 AAAGACTGGGAGGGGGATGAGGG - Intergenic
921472586 1:215567284-215567306 AATGAGGAGGAGGAGGAGGAAGG - Intergenic
921506048 1:215971766-215971788 AATCAATGGGGAAAGGAGGACGG - Intronic
922030955 1:221797667-221797689 ATGGAGTGGGAGAAAGAGGAAGG + Intergenic
922241903 1:223760853-223760875 AATGCCTGGCAGAAGGAAAAGGG - Intronic
922555555 1:226529710-226529732 GATGAGTGGCAGAAGTAGGATGG + Intergenic
923458247 1:234185126-234185148 AAATACTTGCAGAAGGAGGAGGG + Intronic
923854206 1:237828523-237828545 CATGAATGTGGGAAGGAGGAGGG + Intronic
923935701 1:238757314-238757336 AAGGACGGAGAGAGGGAGGAAGG + Intergenic
924003014 1:239574561-239574583 AATGCCTGGATGCAGGAGGAAGG - Intronic
924461475 1:244263398-244263420 AATAAAGGGGAAAAGGAGGAAGG + Intergenic
1062773795 10:127972-127994 ACTGACTGATGGAAGGAGGAAGG + Intergenic
1062781121 10:208769-208791 AATGAGGTGGAGAAGGAAGAAGG + Intronic
1063153201 10:3355388-3355410 AATGCTTGGGAGTAGGAAGAGGG + Intergenic
1063350954 10:5354602-5354624 AAAGACTGGAAGAAGAAGTAAGG - Intergenic
1063614698 10:7591617-7591639 AAAGACTGAGAGGAAGAGGAAGG - Intronic
1063677283 10:8152256-8152278 AATGAATGCGGGAAGGAGGGAGG + Intergenic
1063790985 10:9447534-9447556 AAAGACAGGGAGAGAGAGGAAGG - Intergenic
1063907041 10:10791947-10791969 AAGGAAGGAGAGAAGGAGGAAGG + Intergenic
1064128578 10:12687066-12687088 TATGATTGAGAGAAGGAGGTAGG + Intronic
1065508410 10:26453499-26453521 AATGAGTGGATGGAGGAGGAAGG - Intronic
1065658778 10:27983012-27983034 AAAGGCTGGCAGAGGGAGGAGGG + Intronic
1065932031 10:30488519-30488541 AAGGGCTGAGAGAAAGAGGAAGG + Intergenic
1066061306 10:31725731-31725753 AATGACTGGAAGAAGAGGTAGGG + Intergenic
1067092532 10:43275764-43275786 AAGGACTGGGAGGGGGTGGAAGG - Intergenic
1067525824 10:47038014-47038036 AATGGCTGAAGGAAGGAGGAGGG + Intergenic
1067790715 10:49285488-49285510 AGGGCCTGGGGGAAGGAGGATGG + Intergenic
1067819758 10:49518365-49518387 AAGGGCTTGGAGAAGGAGAAGGG - Intronic
1068122116 10:52791764-52791786 GAGGAGGGGGAGAAGGAGGAAGG + Intergenic
1068646009 10:59469129-59469151 ATTGGGTGGGAGTAGGAGGAAGG + Intergenic
1069534373 10:69242058-69242080 AAGGAATGGGAAAAGGAGAAGGG - Intronic
1069737577 10:70667229-70667251 ATTGACTGGGAGAAGAGAGAGGG + Intergenic
1070026548 10:72637499-72637521 TATGAAAGGGAGAAGGAAGACGG + Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070694149 10:78549397-78549419 AATGGCTTAGAGAAAGAGGAAGG - Intergenic
1070984888 10:80680161-80680183 AAGGTCTGGGGGAAGGAGCATGG - Intergenic
1071358513 10:84821816-84821838 AATGACTGGGTAGAGGATGAAGG + Intergenic
1071384281 10:85104041-85104063 AATTAATGAGACAAGGAGGAAGG - Intergenic
1071794324 10:88989432-88989454 AAGAAGTGGGATAAGGAGGATGG - Intronic
1072520243 10:96224476-96224498 AATCACTGAGGGAAGGAGCATGG - Intronic
1072564042 10:96602752-96602774 AGTGGCTGGGACAAGCAGGAGGG - Intronic
1072778648 10:98227339-98227361 TTTTATTGGGAGAAGGAGGAAGG - Intronic
1072840866 10:98772324-98772346 GATGACTGGGAAACTGAGGATGG + Intronic
1072875805 10:99172179-99172201 AATGGGTGAGAGAAGGAGGGAGG - Intronic
1072986007 10:100141020-100141042 AGGGGCTGGGAGGAGGAGGAAGG + Intergenic
1073142577 10:101258590-101258612 CATCACTGGCAGCAGGAGGATGG + Intergenic
1074085980 10:110209201-110209223 AATAGCTGTGAAAAGGAGGAAGG + Intronic
1074135543 10:110623334-110623356 AAGGACAGAGAGTAGGAGGAGGG - Intergenic
1074827998 10:117228495-117228517 AAGGAAGGGGAGAAGGAGGGAGG - Intergenic
1074917246 10:117969280-117969302 AATTTCTGGGAGCAGAAGGAAGG - Intergenic
1074983593 10:118639032-118639054 AAGGACTGGGCCAGGGAGGAAGG - Intergenic
1075375297 10:121974227-121974249 AATGACCCGGAAAAGGAGAAAGG + Intronic
1075667016 10:124238608-124238630 GATGACTCGGAGCTGGAGGAAGG - Intergenic
1075806048 10:125189555-125189577 AATGAATGAGTGAAGGAGGAAGG - Intergenic
1076558736 10:131347125-131347147 AAGGAATGAGAGAAAGAGGAAGG - Intergenic
1076558762 10:131347254-131347276 AAAGAATGAGAGAAGGAGGAAGG - Intergenic
1077643317 11:3901456-3901478 TATGACTTGGAGAAGTAGTATGG + Intronic
1077649195 11:3954155-3954177 AGAGAATGGGAGAAGAAGGAAGG - Intronic
1077736970 11:4801467-4801489 AATGAGAGAGAGAAGGGGGAGGG + Intronic
1078089346 11:8254692-8254714 GATGACTTGGGGAGGGAGGAAGG - Intronic
1078142821 11:8704054-8704076 AATCCCTGGGGGAAGGGGGAGGG - Intronic
1078248793 11:9600393-9600415 GAACACTGGGAGCAGGAGGATGG - Intergenic
1078829070 11:14961714-14961736 AATGACATGGAGGAGGAAGATGG + Intronic
1079398256 11:20084560-20084582 ATTGAATGGGGGAAGGAAGAAGG + Intronic
1079408033 11:20162488-20162510 AGGGAGTGGGAGAAGGAGGGAGG - Intergenic
1079800907 11:24867421-24867443 AATGACTGGAAGAAAGAGAAGGG - Intronic
1080273388 11:30474552-30474574 AATCAGTGTGGGAAGGAGGATGG - Intronic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1081001566 11:37679899-37679921 AAAAACTGTGAGGAGGAGGAAGG + Intergenic
1081071762 11:38618731-38618753 CATGACTGGGAAGAAGAGGATGG + Intergenic
1081430428 11:42970707-42970729 AATGACTGGCAGATGGGGAAAGG + Intergenic
1081575772 11:44317807-44317829 AATGAAAGGGAGGAGGGGGAAGG - Intergenic
1081588932 11:44407536-44407558 TAGGACTGGGAGATGGGGGAAGG - Intergenic
1082834440 11:57641155-57641177 AGGGACTGGGAGAAGGAGTGAGG + Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1083153745 11:60810081-60810103 AATGACTGAGAAAAGCAGGCGGG - Intergenic
1083341233 11:61959691-61959713 AATGACTGGCTGCAGGAGGGAGG - Intronic
1083812197 11:65112276-65112298 GTCGACTGGGAGCAGGAGGAGGG + Intronic
1084190421 11:67496139-67496161 GATAAAGGGGAGAAGGAGGAGGG - Intronic
1084780163 11:71402787-71402809 ATTGGCTGGGAGAAGCAGGTAGG + Intergenic
1085011011 11:73141920-73141942 AAGGACCAGGAGGAGGAGGAGGG + Exonic
1085317661 11:75555235-75555257 AGGGCCTGGGAGAAGGGGGAAGG - Intergenic
1085322756 11:75584608-75584630 AAGGACTGGGAGGAGGAGGAAGG + Intergenic
1085845776 11:80062821-80062843 AATGACTGGGAAAACCAGAAGGG + Intergenic
1085933126 11:81110517-81110539 AATGACAGGGAGGGGAAGGAGGG - Intergenic
1086280382 11:85179656-85179678 AATGGGTGGGTGAAGGAGAAAGG + Intronic
1086282859 11:85210845-85210867 AATGGAAGGGAGAAGGAAGAAGG - Intronic
1087170493 11:95045080-95045102 AATGAATGGAAGAGGCAGGAAGG - Intergenic
1087706243 11:101495881-101495903 GCTGACTGTGAGAAAGAGGAAGG - Intronic
1088224318 11:107603010-107603032 GTTGAGTGGGAGAAGAAGGATGG + Intronic
1088536798 11:110870246-110870268 AATGACTGTGAGTAGCAGGCAGG + Intergenic
1089014193 11:115153501-115153523 AATGCCTGGCACACGGAGGACGG + Intergenic
1089023102 11:115238675-115238697 AGTGATTGTGAGAAGGTGGACGG + Intronic
1089133636 11:116232101-116232123 AAGGGCTGGGGGAAGGAGGTGGG - Intergenic
1089767016 11:120775320-120775342 GATGACGGGGAGGAGGAGGAAGG + Intronic
1090047831 11:123351454-123351476 AGCTCCTGGGAGAAGGAGGAGGG + Intergenic
1091106484 11:132924230-132924252 AATGCTTGGGGGATGGAGGATGG + Intronic
1091528455 12:1330419-1330441 AAAAACTGGGAGAAGGAGTGAGG - Intronic
1091584591 12:1808905-1808927 CATGAAAGGGAGAAGGGGGAGGG + Intronic
1091919176 12:4290585-4290607 AATGCCTGGGGGCAGGAGGAGGG - Intronic
1092769851 12:11886756-11886778 AAGAACTGGAAGAAGAAGGAGGG + Intronic
1092818512 12:12331703-12331725 TCTGACAGGGAGGAGGAGGAGGG + Intronic
1093956489 12:25225907-25225929 AATAACTAGTAGAAGAAGGAAGG - Intronic
1094062127 12:26325666-26325688 TATGACTGGAGGAAGAAGGAAGG - Intergenic
1094363744 12:29658453-29658475 AATGATCAGGAGAAGAAGGAAGG - Intronic
1096321029 12:50612906-50612928 AGTGCCTGGGAGAAAGATGATGG - Intronic
1096465540 12:51846353-51846375 AAAGACAGGGACAATGAGGAAGG + Intergenic
1096510089 12:52122893-52122915 AAAGACATGTAGAAGGAGGAAGG - Intergenic
1096603783 12:52749901-52749923 ATGTCCTGGGAGAAGGAGGAAGG + Intergenic
1096694203 12:53338515-53338537 ACTGAAGGGGAAAAGGAGGAAGG + Intronic
1096777411 12:53972803-53972825 CAGGATTGGGGGAAGGAGGAGGG - Intergenic
1097329244 12:58315219-58315241 AATGACTGGATGATAGAGGAGGG + Intergenic
1098622175 12:72614984-72615006 TATAAATTGGAGAAGGAGGAGGG + Intronic
1099135173 12:78888797-78888819 AGTGACAGTGAGCAGGAGGAAGG - Intronic
1099965446 12:89440459-89440481 AATGGCTGGGGGAAGGATGAAGG + Intronic
1101199035 12:102415618-102415640 AAAGACAGAGAGAAGAAGGAAGG - Intronic
1101372319 12:104140605-104140627 GATGACTTGGTGAAAGAGGAAGG + Intergenic
1101528102 12:105549909-105549931 AGTGAATGGGAGAAGGAAGAAGG - Intergenic
1102230355 12:111257588-111257610 AGTGAGGAGGAGAAGGAGGAGGG - Intronic
1102303087 12:111785071-111785093 AAAGGCAGGGAGGAGGAGGAAGG - Intronic
1102538833 12:113603289-113603311 AATAATTAGGAGAAGGTGGAAGG - Intergenic
1102558772 12:113747387-113747409 AATGACTGGGAGAAGAAGCTGGG + Intergenic
1102889064 12:116544083-116544105 AAGGACTGGGAAAAGGAGATTGG - Intergenic
1102955284 12:117054816-117054838 GATGGCTGGGAAACGGAGGATGG - Intronic
1103309227 12:119990421-119990443 AATGAATGGGGGAGGGAGGATGG + Intronic
1103832603 12:123791916-123791938 AATGACAGCAAGAATGAGGAAGG - Intronic
1104298142 12:127537723-127537745 AATGAGGGGGAGAGGGATGACGG + Intergenic
1104355284 12:128079737-128079759 AATGATGGGGAGCAGGAGGGTGG + Intergenic
1104658738 12:130593305-130593327 AATGGCTGGGCCCAGGAGGATGG + Intronic
1104676027 12:130713160-130713182 AAAGAGTGAGAGAAGAAGGAAGG + Intronic
1106352096 13:28940853-28940875 AATGAGTGGGGGATGGAGGCTGG + Intronic
1106544030 13:30715053-30715075 ATTGACCTGGAGAAGGAGCAAGG - Intronic
1106883503 13:34157515-34157537 AATGACTGGGGGATAGGGGAAGG + Intergenic
1107344053 13:39440219-39440241 AAGGACTGGGTGAAGGTGGTGGG + Intronic
1107387551 13:39928428-39928450 AATGAGCTGGGGAAGGAGGAAGG - Intergenic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1109473624 13:62846908-62846930 AGAGGCAGGGAGAAGGAGGATGG - Intergenic
1109929752 13:69199435-69199457 AATAAATGGGGGAATGAGGAAGG + Intergenic
1110197409 13:72806200-72806222 AATGACTGGGGGAGGGGAGAGGG - Intronic
1110215661 13:73021847-73021869 AAAGAGGGAGAGAAGGAGGACGG + Intergenic
1111086426 13:83380719-83380741 AGGGAGTGGGAGGAGGAGGAAGG - Intergenic
1111681967 13:91453788-91453810 AAAGAAAGGAAGAAGGAGGAGGG - Intronic
1111899764 13:94186434-94186456 AAAGACTGGGTGAAGTAGAATGG - Intronic
1112280157 13:98055956-98055978 AATTTCTGGCAGAGGGAGGAGGG + Intergenic
1112744626 13:102512641-102512663 AAGGACTGGGAGAAGGAAGTTGG - Intergenic
1112924741 13:104660435-104660457 ATTGTCTGGGAGATGGAGGGAGG - Intergenic
1113425151 13:110201393-110201415 AAGGAGGGGGAGTAGGAGGAGGG + Intronic
1113427423 13:110220675-110220697 AATGATAGTCAGAAGGAGGACGG - Intronic
1113695047 13:112339379-112339401 AATGATTAGCTGAAGGAGGAAGG + Intergenic
1114150319 14:20031272-20031294 AATGGCAGGCAGAAGGAGGGCGG + Intergenic
1114364242 14:22010019-22010041 GATGAGGAGGAGAAGGAGGAAGG + Intergenic
1114447687 14:22802027-22802049 ATTTACTGTGAGGAGGAGGATGG - Intronic
1114587110 14:23825331-23825353 CTTGACTGGAATAAGGAGGAAGG - Intergenic
1114618413 14:24080913-24080935 AGTGAATGGGAGGTGGAGGAGGG - Exonic
1114656466 14:24318800-24318822 ACAGACTTGGAGAAGGAAGAGGG + Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1116416992 14:44689868-44689890 AAGGAGGGGGAGGAGGAGGAGGG + Intergenic
1116583147 14:46668399-46668421 AATGACTGGGAGGAGGCATATGG + Intergenic
1117438729 14:55741369-55741391 GAGGCCTGGGGGAAGGAGGAGGG + Intergenic
1118566104 14:67142739-67142761 AATGACTGGGACAGTTAGGATGG - Intronic
1118975357 14:70671708-70671730 AACGAGTGGGGGAAGGAGGCAGG - Exonic
1119065905 14:71526327-71526349 ACAGACTGGGAGAAGGAAAAGGG - Intronic
1119117920 14:72044491-72044513 AAGGAGAGGGAGAGGGAGGAAGG - Intronic
1119199540 14:72742464-72742486 AAGAACGGGGAGATGGAGGAAGG - Intronic
1119757873 14:77131550-77131572 AATGGGAGGGAGAGGGAGGAGGG - Exonic
1120055709 14:79921540-79921562 ACTGAGTGGGTGAAGGAGGAAGG + Intergenic
1120255767 14:82117484-82117506 TATGAGAGGGAGATGGAGGAAGG + Intergenic
1120260750 14:82182121-82182143 AATGACTGGCTGCAGGAGTATGG - Intergenic
1120393423 14:83937553-83937575 AAGAACTCGGAGAAGGAGGATGG - Intergenic
1120653860 14:87166373-87166395 AATGACTGGGGGAGGATGGATGG - Intergenic
1120891074 14:89491742-89491764 AATGACTAAGAGAAGCATGAAGG - Intronic
1121521161 14:94587134-94587156 GATGACGGGGAGAGGAAGGAGGG - Intronic
1122276160 14:100591845-100591867 AATGGCTGGGAGAAGACGGGAGG - Intergenic
1122873245 14:104650972-104650994 AATGGCTGGGAGTGGGAGGGTGG + Intergenic
1124099720 15:26682278-26682300 AGGGAGTGGGAGAGGGAGGAAGG - Intronic
1125489668 15:40137175-40137197 AATGCCTGGAAGAAGTGGGAGGG + Intergenic
1125785919 15:42317960-42317982 ATTGGATGGGAGACGGAGGAGGG - Intronic
1125857397 15:42963534-42963556 AGTGACTGAGAAAAGAAGGAAGG - Intronic
1126037153 15:44557318-44557340 AATGGCTGGGTGAGGGGGGAGGG - Intronic
1126166659 15:45659316-45659338 AAGGACTGGGAGGAAGTGGAGGG + Intronic
1126475843 15:49064129-49064151 AATGATTGGGAGATGGAAAAGGG - Intergenic
1126510194 15:49462685-49462707 ATTGAATGAGAGAAAGAGGAAGG - Intronic
1126792748 15:52235990-52236012 AATGACTGAAACAAGGAGAAAGG + Intronic
1126940858 15:53763514-53763536 AGTGACTTGCAGTAGGAGGAAGG - Intergenic
1126980685 15:54239226-54239248 AATGACAGAAAGAAGAAGGAAGG - Intronic
1127292435 15:57582438-57582460 AAAGACTTGGAGAAAGAGGGAGG - Intergenic
1127547173 15:60002421-60002443 AATAACTGGGAGGAGGAGATGGG - Intergenic
1127585873 15:60377253-60377275 AATATCAAGGAGAAGGAGGAAGG + Intronic
1127950458 15:63800451-63800473 ATTAACTGGGTGAAAGAGGATGG - Intronic
1128566642 15:68705112-68705134 CATTACTGGGAGAAGGAGACGGG - Intronic
1129001976 15:72342714-72342736 AATGGTTGGGAGGAGGGGGATGG + Exonic
1129467087 15:75730298-75730320 AGAGAAGGGGAGAAGGAGGATGG + Intergenic
1129720140 15:77873422-77873444 AGGGAAGGGGAGAAGGAGGATGG - Intergenic
1130128714 15:81117841-81117863 AAGGACTAGGAGAATGAGGATGG - Intronic
1130927481 15:88396426-88396448 AAGGAAGGGGAGAAGGAGGAGGG - Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131334067 15:91530704-91530726 AATGATTGGAAGAAGGAAGCAGG - Intergenic
1131781806 15:95867819-95867841 AATGACTGGCAGGAGATGGAGGG + Intergenic
1131852113 15:96554582-96554604 AAAGAGTAGGAGAAGGAGGGAGG - Intergenic
1132221397 15:100108153-100108175 AAGGAATGCGAGAAGAAGGAAGG - Intronic
1132560137 16:589857-589879 AATGGCTGAGGGAAGGAGGGCGG + Intronic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1133088905 16:3388328-3388350 AAAGACTTGCTGAAGGAGGAGGG - Intronic
1133485421 16:6214732-6214754 AAGGAGAGGGAGAAGGAGAAGGG + Intronic
1133530878 16:6653809-6653831 GATGAATGGGAGAAGGATGCAGG + Intronic
1133681494 16:8124346-8124368 GACTACTGGGACAAGGAGGATGG + Intergenic
1133728942 16:8561712-8561734 AATGAATGAGTGAGGGAGGAAGG + Intergenic
1133728994 16:8562747-8562769 AATGAGTGAGTGAAGGAGGGAGG + Intergenic
1133754813 16:8754410-8754432 GGTGACTGGTAGAAGGAAGAGGG + Intronic
1133940089 16:10301999-10302021 AACTACTGGGAGAACCAGGAAGG + Intergenic
1134792167 16:16998857-16998879 ATGGACTGGGTGAAGAAGGAAGG + Intergenic
1135170434 16:20178908-20178930 AAAGACAAGAAGAAGGAGGAGGG - Intergenic
1135187413 16:20327235-20327257 AATATCTGGGACAAGGAAGAGGG + Intronic
1135612466 16:23880369-23880391 AAGGAGGGGGAGAAGGAGGCAGG - Intronic
1135694693 16:24575754-24575776 AAAGAGAGGGAGAGGGAGGAGGG + Intergenic
1135939591 16:26809742-26809764 AATGCAAGGGAGAAGGAGGAAGG + Intergenic
1137476385 16:48812996-48813018 AATGGCTAGCAGAAGAAGGATGG + Intergenic
1137683373 16:50369421-50369443 GAAGAGTGGGGGAAGGAGGAAGG - Intergenic
1138093520 16:54194844-54194866 GAAGAATGGGAGAAGGAGGAGGG + Intergenic
1138187847 16:54989929-54989951 AAAGACTGGGAGGGGGATGAGGG - Intergenic
1138524117 16:57592044-57592066 GATGAGTGGATGAAGGAGGAAGG - Intergenic
1139478644 16:67216045-67216067 AAAGAGCAGGAGAAGGAGGAAGG - Intronic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139966108 16:70746350-70746372 CATGAGTGGGAGAGGGATGAAGG - Intronic
1139994692 16:70968643-70968665 AATGACTTGGGCAAGGAGAAGGG - Intronic
1140170446 16:72598860-72598882 ACTGAGTGGGAGGAGGAAGAGGG + Intergenic
1140466192 16:75184971-75184993 AATAACTGGCTGAAGGAGGGAGG + Intergenic
1140700335 16:77575391-77575413 AGTGACGGGGAGAGGAAGGAAGG - Intergenic
1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG + Intronic
1140798616 16:78464261-78464283 GATGACAGGGAGATGGAGGGAGG + Intronic
1140814784 16:78611497-78611519 AGTGTCTGTGGGAAGGAGGAGGG - Intronic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141216971 16:82033760-82033782 AATGAGGGGCAGGAGGAGGAAGG - Intergenic
1141514578 16:84535154-84535176 GAGGAGTGGGAGAAGGAGGAGGG - Intronic
1141775660 16:86121427-86121449 GATTGCAGGGAGAAGGAGGAGGG - Intergenic
1141775807 16:86121912-86121934 AGGGACAGGGAGGAGGAGGATGG - Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1142169147 16:88611481-88611503 AAGGAGCGGGAGAAGGAGAAGGG + Exonic
1143164288 17:4890130-4890152 AGCGAGTTGGAGAAGGAGGAAGG - Intronic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1143499766 17:7331864-7331886 AATGACTGGGAAAATGAGGGAGG + Intergenic
1143512988 17:7405979-7406001 AGGGATAGGGAGAAGGAGGAGGG + Intronic
1143634008 17:8154177-8154199 AAAGACAGGGAGATGGAGGCGGG - Intronic
1143655454 17:8291107-8291129 AAAAACAGTGAGAAGGAGGAAGG + Intronic
1145217938 17:21066256-21066278 AATGCCTGGCAGAAGGGGGCTGG - Intergenic
1145973850 17:28972890-28972912 GAGCACTGGGAGAAGGAGGAAGG + Intronic
1146073408 17:29705071-29705093 AACAACTGGGAGAATGAGGCTGG - Intronic
1146736388 17:35242556-35242578 AATTACTAGGAGAAGGAGGGAGG + Intergenic
1146908635 17:36633644-36633666 GAGGAAGGGGAGAAGGAGGAGGG + Intergenic
1147162411 17:38575863-38575885 AATGAATGAGAGAATGAGGGAGG - Intronic
1147606316 17:41775739-41775761 AAGGACAGGAAGAAGGAAGACGG + Intronic
1148282530 17:46360119-46360141 AATGACTGGGAGGAGGCACAAGG - Intronic
1148304748 17:46578044-46578066 AATGACTGGGAGGAGGCACAAGG - Intronic
1148600580 17:48891535-48891557 AATTACTGGGTCAAAGAGGATGG + Intergenic
1148774394 17:50087552-50087574 TGTGCCTGGGAGAAGCAGGAAGG + Intronic
1148812114 17:50300024-50300046 AATTACTGGGTGAGGGTGGAGGG - Intergenic
1149103051 17:52928834-52928856 AATTAGGAGGAGAAGGAGGATGG + Intergenic
1149107083 17:52982591-52982613 GAGGAGGGGGAGAAGGAGGAAGG - Intergenic
1149151618 17:53571559-53571581 AAGGACTGGGAGTAGGAAGGAGG - Intergenic
1149622480 17:58056135-58056157 AAAGACTGGGAGAAGAGGGAAGG + Intergenic
1150000694 17:61437134-61437156 AAGGAGAGGGAGAGGGAGGAAGG - Intergenic
1150846997 17:68669207-68669229 AATTGTTGGGAGAAGGAGGGAGG + Intergenic
1150859268 17:68784370-68784392 AGTGACTGGGAGAAATAGGCTGG - Intergenic
1151028732 17:70710234-70710256 AATGCCTTGGAGTAGGAGGCAGG + Intergenic
1152176818 17:78793319-78793341 AAAGAATGGGAGAGAGAGGAAGG + Intronic
1152185744 17:78855443-78855465 AGTGCCTGGCAGAGGGAGGATGG + Exonic
1152318234 17:79593243-79593265 AAGAGCTGGGAGAAGGAGGAAGG - Intergenic
1152444097 17:80330590-80330612 AATCTCAGGGGGAAGGAGGATGG - Intronic
1153212017 18:2777440-2777462 AATGACTAGGGGAAGGGGCAAGG - Intronic
1153448213 18:5197091-5197113 AAAGACAGGCAGACGGAGGATGG + Exonic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1154384853 18:13884025-13884047 ACTAACAGGGAGAAAGAGGAGGG + Exonic
1155079217 18:22391226-22391248 CATCACTGGGAGAATGTGGATGG - Intergenic
1155218485 18:23663444-23663466 AATAACGCGGAGGAGGAGGAGGG - Intergenic
1155402780 18:25457370-25457392 AATGACATGCAGAAGGAGCAGGG + Intergenic
1155546772 18:26923979-26924001 GATGACAGGGAGAGGCAGGAGGG + Intronic
1155620928 18:27778661-27778683 AATGGCTGGGAGAAGGAACTGGG - Intergenic
1155883022 18:31173835-31173857 AATAGCTGGGATAGGGAGGAAGG - Intergenic
1155936852 18:31763481-31763503 AATCACTGGGATCAGGGGGATGG + Intergenic
1156791699 18:40983823-40983845 AAGGAGGTGGAGAAGGAGGAGGG - Intergenic
1157385587 18:47257372-47257394 AAGGAGTGGGAGTAGGGGGAGGG + Intergenic
1157423101 18:47562558-47562580 AATGTCAGGGATTAGGAGGATGG - Intergenic
1157469407 18:47977113-47977135 AGTGACTGGAAGTAGGAGAAGGG + Intergenic
1157874168 18:51256183-51256205 AATGACTGAAAGAAGGGAGAGGG + Intergenic
1157922636 18:51729149-51729171 ACTGTCTGGGAGATGGAGTAAGG - Intergenic
1158149319 18:54349644-54349666 AAAGGGTGGGAGGAGGAGGATGG - Intronic
1158220937 18:55149986-55150008 TGTGGATGGGAGAAGGAGGAGGG + Intergenic
1158561085 18:58514289-58514311 AAAAACTGGGAGAAGGAAGAAGG - Intronic
1158916639 18:62138032-62138054 AATGGCTGGAAGAGGGATGAGGG - Intronic
1158986154 18:62819169-62819191 AAAGACTGGGAGAAGGGAAATGG + Intronic
1159046918 18:63377597-63377619 AAGGAAGGGGGGAAGGAGGAAGG - Intergenic
1159142661 18:64416567-64416589 AATTAGTGGGGGAAAGAGGAAGG - Intergenic
1159247470 18:65828021-65828043 AACTACGTGGAGAAGGAGGAGGG - Intronic
1159754323 18:72345177-72345199 AATAAATGGCAGAATGAGGAAGG + Intergenic
1159912122 18:74155450-74155472 AATGTCTGGGAGGAGGAAGTGGG + Intronic
1160057656 18:75499541-75499563 AAGGAGTAGGAGAAGGAGAAGGG + Intergenic
1160816886 19:1040202-1040224 AAGGACTCGGAGAGGGAAGAAGG + Intronic
1161239356 19:3213406-3213428 AAGGAAGGGGAGAGGGAGGAGGG + Intergenic
1161673089 19:5625065-5625087 AATGAAAAGGAGAAGGAAGAAGG - Intronic
1162053096 19:8046815-8046837 GAGGAGGGGGAGAAGGAGGAGGG - Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162104564 19:8362545-8362567 AATGAGGGAGAGAAAGAGGAAGG + Intronic
1162777779 19:12990225-12990247 GATGTCTGGGAGAAGGAGTTGGG - Intergenic
1163144747 19:15372957-15372979 ATGGACTGGGAGAAGAGGGACGG + Exonic
1163781252 19:19249876-19249898 GAGGACTGGGAGAAGGACGAAGG + Exonic
1164592132 19:29512900-29512922 GAAGTCTTGGAGAAGGAGGAAGG + Intergenic
1164866466 19:31608347-31608369 AGTGGCTGACAGAAGGAGGAAGG + Intergenic
1164921808 19:32093907-32093929 AGTGAGTGGGATAAGAAGGAAGG + Intergenic
1165026988 19:32969459-32969481 CATGAATGGCAGCAGGAGGAAGG - Intronic
1165136186 19:33671009-33671031 GATGACTGGGAGAAGGAGGCTGG - Intronic
1165907922 19:39204891-39204913 AAAGACTGGGAGGGGGAGGCAGG + Intergenic
1166387456 19:42390159-42390181 TATGAGTGGGATGAGGAGGAGGG + Intronic
1166528181 19:43526345-43526367 ATTCACTGGGAGAGAGAGGAGGG + Exonic
1166696660 19:44855608-44855630 AATGCCTGGAAGACGGAGTAGGG - Intronic
1166936983 19:46339854-46339876 AAATCCTGAGAGAAGGAGGAGGG - Exonic
1167049365 19:47069091-47069113 CAGGACCGGGAGAATGAGGAAGG - Exonic
1167333117 19:48868581-48868603 AGAAACTGGGAGAGGGAGGAAGG - Exonic
1167966300 19:53149911-53149933 AAGGTATGGGAGAAGGAGCATGG - Intronic
1168109203 19:54182063-54182085 AAGGACGGAGGGAAGGAGGAAGG + Intronic
1168307545 19:55443456-55443478 AAAGAAGGGGAGGAGGAGGAGGG + Intergenic
1168357719 19:55712862-55712884 AAGGAGGGGGAGGAGGAGGAGGG + Intronic
1168657673 19:58142832-58142854 GATGAGAGGGAGAAGGAGAAAGG - Intronic
925156716 2:1653763-1653785 AATCATTTGGAGAACGAGGACGG + Exonic
925831372 2:7899269-7899291 TATGAGTAGGAGCAGGAGGAAGG - Intergenic
925853346 2:8105650-8105672 AAAGAGAGGGAAAAGGAGGAAGG - Intergenic
926320583 2:11746334-11746356 GATGACTGGGGGAGTGAGGACGG - Intronic
926569479 2:14513691-14513713 AACAACTGGGAGAAGGCAGAAGG + Intergenic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927558920 2:24055139-24055161 AATGACTGGGAGAAGGCATCAGG - Intronic
927705637 2:25294879-25294901 AATGGGAGGGAGGAGGAGGAGGG - Intronic
927962689 2:27250585-27250607 AGTGACTGGGCGGAGGAGCATGG - Intergenic
928265205 2:29805491-29805513 CCTGTCTGGGAGCAGGAGGAAGG - Intronic
928606202 2:32947112-32947134 TGTGGCTGGGAGCAGGAGGAGGG - Exonic
928700932 2:33897755-33897777 AATGACTGGGATGAGGGGTATGG + Intergenic
929460533 2:42099682-42099704 AATGAATGAGAGAAAGAGGAAGG - Intergenic
929938821 2:46314961-46314983 GATGCCAGGGAGAAGGAGGCAGG + Intronic
930075495 2:47402725-47402747 AAATACTGGGAGGAGGAGGAAGG + Intergenic
930113885 2:47702212-47702234 AATGACTTGGAGGCAGAGGACGG - Intronic
930208238 2:48609536-48609558 AATGAGTAGGAGACAGAGGAAGG - Intronic
930429760 2:51259807-51259829 AATAACAGAGAGGAGGAGGACGG + Intergenic
930923332 2:56784543-56784565 AAAGACAGGGAAAAGGTGGATGG - Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931140624 2:59453660-59453682 CCAGACCGGGAGAAGGAGGAAGG - Intergenic
931285766 2:60830338-60830360 CATGCCAGGCAGAAGGAGGAAGG + Intergenic
931603902 2:64032431-64032453 AGTGATTGGGAGAAGCATGAGGG + Intergenic
931651171 2:64470232-64470254 AATGTCTGTGAAAAGGAGAATGG - Intergenic
931774270 2:65526723-65526745 GATGATTGGGAGAGGGAGGGTGG + Intergenic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
932088128 2:68780598-68780620 AAGGAAGGGGAGAAGGGGGAAGG - Intronic
932369684 2:71176793-71176815 AAAGAAGGGGAGAAGGAGGAAGG - Intergenic
932395776 2:71446469-71446491 AATGATTGGGCAAAGGAGCACGG + Intergenic
933033264 2:77359480-77359502 AATGATCAGGAGATGGAGGAGGG - Intronic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933370642 2:81411254-81411276 AATTAGTGGGAGGAGGAGGAGGG + Intergenic
933379520 2:81525124-81525146 AATTATTCTGAGAAGGAGGATGG - Intergenic
933588473 2:84205574-84205596 AGTTACTGGGAAACGGAGGAAGG + Intergenic
933588494 2:84205830-84205852 AGTAACTGGGAAATGGAGGAAGG + Intergenic
934062243 2:88305971-88305993 GATGACTGGTTGAATGAGGAGGG - Intergenic
934090344 2:88545509-88545531 AATGGCAGTGAGAAGGAGGTTGG + Intergenic
934139446 2:89031565-89031587 AATGACTAAGAGAAGGACCAAGG + Intergenic
934229793 2:90168978-90169000 AATGACTAAGAGAAGGAGCAAGG - Intergenic
934765038 2:96875927-96875949 AGTGACAGGGAGACAGAGGAAGG + Exonic
935112968 2:100108632-100108654 ACTGGCTGGGAAAAGGAGGGAGG + Intronic
935265754 2:101392453-101392475 AATGACACACAGAAGGAGGAAGG + Intergenic
935626659 2:105177269-105177291 AAGGAAGGAGAGAAGGAGGAAGG - Intergenic
936256733 2:110922111-110922133 AATGACTGCAAGAAGGGGGTTGG + Intronic
936278206 2:111118356-111118378 ACGGACTGGGAGAAGGAAGTGGG + Intergenic
936487387 2:112937960-112937982 AAGGAGTGGGTGATGGAGGAAGG + Intergenic
937198285 2:120179869-120179891 ACTGACAGGAAGATGGAGGATGG + Intergenic
938053011 2:128192249-128192271 AAAAACTGGCAGGAGGAGGAGGG - Exonic
938154502 2:128921411-128921433 AAAGAAAAGGAGAAGGAGGAAGG - Intergenic
938541194 2:132285364-132285386 TATGAATGGGAGAAGGCAGAAGG + Intergenic
938976335 2:136481786-136481808 AATGACTAGGAGAAGTGGCAGGG + Intergenic
939427376 2:142056813-142056835 AAGATATGGGAGAAGGAGGAAGG - Intronic
939557885 2:143698867-143698889 TATGACTGGTGGGAGGAGGAAGG - Intronic
940228329 2:151423960-151423982 GATGTCTGGGTGCAGGAGGAGGG - Intronic
940383008 2:153037300-153037322 AAGGACTGGGGGAGGTAGGAGGG - Intergenic
940599743 2:155843975-155843997 CATGAGTGGGAGAGTGAGGAAGG + Intergenic
940761696 2:157745631-157745653 AATGACTGGGGGCAGGAATATGG - Intronic
940982083 2:160014902-160014924 AAGGACAGGGAGAGGGAGGCTGG + Intronic
941014137 2:160335309-160335331 AGTAGCTGGGAGAAGGAGGGTGG + Intronic
941567908 2:167131455-167131477 AGTGACTGGGAGATGGTGAATGG - Intronic
941863821 2:170313062-170313084 AATTACTGGGAGTAGAAGAAGGG - Intronic
942231037 2:173861006-173861028 AGAGGCTGGGAGAAGGAGCAGGG + Intergenic
943024878 2:182615796-182615818 AAGGAGAGGGAGAAGGAAGAGGG + Intergenic
944328770 2:198440517-198440539 AATAAATAGGAGAATGAGGAGGG + Intronic
944353072 2:198753366-198753388 AATAACTGGAAGGAGAAGGAGGG + Intergenic
944543405 2:200775874-200775896 ATGGACTGGGAGAAGGGGGTGGG + Intergenic
945171126 2:206996200-206996222 GATGACTGGGGGGATGAGGATGG + Intergenic
946100382 2:217315499-217315521 AAAGACTGGGAGGAAGAGGGCGG + Intronic
946335851 2:219036031-219036053 CAGGACTGGGAGGAGGAAGAGGG - Intronic
947018244 2:225645400-225645422 AATGAAGGAGAGAAGGAGGGAGG - Intronic
947157952 2:227182460-227182482 AATGAATGAGAGAATCAGGAGGG - Intronic
947941896 2:234064129-234064151 AATGAGGGGGAGAAGGAAGAGGG - Intronic
948091780 2:235301718-235301740 GATGAGGGGGAGAAGGGGGAAGG - Intergenic
948206687 2:236166487-236166509 AATGACGGTGGGAAGGAGAAAGG - Intronic
948428354 2:237902408-237902430 AAGGACAGGGAGATGGAGGAGGG + Intronic
948771771 2:240254951-240254973 AAGGACTAGGGGAAGAAGGATGG - Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1169006765 20:2213718-2213740 AAGAAATGGGAGAGGGAGGAAGG + Intergenic
1169417416 20:5429383-5429405 CCTGACTGGGAGAAAGAGGCAGG - Intergenic
1169537819 20:6564766-6564788 GAGGAATGGGAGAAGCAGGATGG - Intergenic
1169550062 20:6693234-6693256 AATGCCTGGTAGTAGGAAGATGG - Intergenic
1169752120 20:9005076-9005098 AAAGACTGGGAGAAAGAAAAAGG - Intergenic
1169963867 20:11193496-11193518 TATGACTGGTAGAATGAGGTTGG - Intergenic
1170029826 20:11933082-11933104 ATTGGCTGGAAGAGGGAGGAAGG + Intergenic
1170585474 20:17730924-17730946 AAAGACAGGGAGGAGGAAGAAGG + Intronic
1171255802 20:23688311-23688333 CATGACTTGGGGAAGGAAGAAGG + Intronic
1171778036 20:29389066-29389088 GATGAAGGAGAGAAGGAGGAGGG - Intergenic
1171997237 20:31741197-31741219 AGTTCCTGGGAGAAAGAGGAGGG + Intronic
1172014651 20:31865857-31865879 GATGCTTGGGAGAAGCAGGAAGG + Intronic
1172230609 20:33333350-33333372 AATCCCTGGGAGCAGCAGGATGG + Intergenic
1172946118 20:38690783-38690805 GATGATTGGCAGATGGAGGAAGG - Intergenic
1173112405 20:40204604-40204626 AAAGAAAGGAAGAAGGAGGAAGG - Intergenic
1173127637 20:40354520-40354542 AATGTCCGGGAGCAGGAAGAAGG + Intergenic
1173351964 20:42253533-42253555 GGGAACTGGGAGAAGGAGGAGGG + Intronic
1173452838 20:43180388-43180410 TATGACAGGGAGAGAGAGGAAGG - Intronic
1173661365 20:44736329-44736351 GATGATTGGGAGAAGGAGAGAGG - Intergenic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1174184975 20:48699962-48699984 AATGGATGGTAGAAGGAGGCAGG - Intronic
1174523767 20:51155242-51155264 AATGACAGGGGAAAGGAGGGCGG + Intergenic
1174729781 20:52904580-52904602 AAACATTGGGAGAGGGAGGAGGG + Intergenic
1174842576 20:53914242-53914264 AAAGACTGGGAGGAGGAGGTGGG - Intergenic
1175213562 20:57377243-57377265 AAGGACTGGAAGAGGGAGGTGGG - Intronic
1175506683 20:59490968-59490990 AATGACTGAGAGAAAACGGACGG - Intergenic
1175674563 20:60935622-60935644 AGGGAAGGGGAGAAGGAGGAAGG - Intergenic
1175998074 20:62820211-62820233 CATGGCAGGGAGAAGGGGGATGG + Intronic
1176309124 21:5140521-5140543 GCAGACTGGGAGAAGGATGAGGG - Intronic
1176697330 21:9995236-9995258 AAGGAGGGGGAGAAGGAAGAAGG + Intergenic
1177226498 21:18264166-18264188 AATGTCTGGTAGATGGAGGAGGG + Intronic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178218817 21:30631611-30631633 AATGAATGGGAGGTGGAGGCAGG + Intergenic
1178373808 21:32050075-32050097 AATGACAGGCAGAAGGTAGACGG + Intergenic
1179009813 21:37547510-37547532 AATGACTCGGCTAAAGAGGAAGG - Intergenic
1179160220 21:38890039-38890061 GAGGACTGGGAGATGGGGGAAGG - Intergenic
1179377375 21:40862734-40862756 TTAGACTGGGTGAAGGAGGATGG + Intergenic
1179467014 21:41582562-41582584 AAAGAATGGGAGAAGGAAGGTGG - Intergenic
1179536377 21:42055400-42055422 AATAGCAGGGAGGAGGAGGAAGG + Intergenic
1179847937 21:44121512-44121534 GCAGACTGGGAGAAGGATGAGGG + Intronic
1180226692 21:46397712-46397734 CGTGACTGTGAGAAGGAGCATGG - Intronic
1180259460 21:46658781-46658803 GATGCCTGGCTGAAGGAGGACGG + Exonic
1180990108 22:19930588-19930610 AAGGACAGGGACAAGCAGGAGGG + Intronic
1181542209 22:23579600-23579622 GAGGAGTGGGAGGAGGAGGAGGG + Intronic
1181666133 22:24398849-24398871 AGGGACTGGGTGAGGGAGGAAGG - Intronic
1181923395 22:26338362-26338384 AATGATGGGGAGAAGGCAGAGGG - Intronic
1182087730 22:27573241-27573263 GGTGACTGTGAGGAGGAGGAAGG + Intergenic
1183199537 22:36376348-36376370 ATTGCCTGGGAGGAGGAGGGAGG - Intronic
1183729958 22:39612829-39612851 AAGGAGGGAGAGAAGGAGGAAGG - Intronic
1184449686 22:44575634-44575656 GATGACAAGGAGAAGGGGGATGG + Intergenic
1184733020 22:46381378-46381400 AATGGCAGGAAGAAGGAGGGCGG + Intronic
1185136074 22:49073398-49073420 AATGAATGTGAGAAGGAGCTTGG + Intergenic
949256945 3:2060040-2060062 TATGACTGGGAAAAGGAAGGTGG - Intergenic
949295330 3:2514957-2514979 ACAGACAGGGAGAAGGAGAAGGG - Intronic
949472585 3:4412504-4412526 AATAGCTGGGAGAGGTAGGAAGG + Intronic
949797158 3:7863833-7863855 AATGCATTGGAGAAGGAAGATGG + Intergenic
949944407 3:9178733-9178755 AGGGACTGGGAGGAGGAGGTAGG - Intronic
949995464 3:9613075-9613097 AATAACTGGGATGAGGAGAATGG - Intergenic
950155641 3:10719676-10719698 CATGAATGGGAGAGAGAGGAAGG + Intergenic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
951802822 3:26615380-26615402 AGTTAGAGGGAGAAGGAGGAGGG + Intergenic
952029299 3:29121291-29121313 AATGAGAGAGAGAAGGAGGGAGG + Intergenic
952450345 3:33426360-33426382 ACTGATTGGGAGAATGATGAGGG + Intronic
953007078 3:38988531-38988553 AATGGCAGGGAGATGGAGTAAGG - Intergenic
953027160 3:39151949-39151971 AATGAATGAGAGAGGGAAGAAGG - Intronic
953143879 3:40254938-40254960 AATGATAGGGAGGAAGAGGAAGG - Intronic
953662611 3:44901957-44901979 AATTCCTGGGAGAAGGAGACAGG - Intronic
953799484 3:46011414-46011436 AGGGACTGGGACAAGGATGAAGG - Intergenic
954046527 3:47936092-47936114 AAAGAAGGGGAGAAAGAGGAGGG + Intronic
954409269 3:50363328-50363350 ATGGACTGGGAGGAGGGGGAGGG - Intronic
954492857 3:50923593-50923615 AATCACTGGGGAATGGAGGAGGG + Intronic
954573847 3:51663844-51663866 AATGAGTGAGAGAAGGAGGGTGG + Exonic
954797873 3:53170670-53170692 AATGGCTGGGGAATGGAGGAGGG - Intronic
955349279 3:58182149-58182171 AAAGAAGGGGAGGAGGAGGAAGG + Intergenic
955425941 3:58790161-58790183 AATAATTAGAAGAAGGAGGAAGG - Intronic
955444449 3:58994575-58994597 AAAAACTGGGGGAAGGGGGAAGG - Intronic
955732085 3:61997719-61997741 AATGACTGGCAGAAAAAGGTGGG - Intronic
956126859 3:66018790-66018812 AATGACTTGAAAGAGGAGGATGG - Intronic
956181952 3:66525358-66525380 AAAGAAGGGGAGGAGGAGGAAGG - Intergenic
956324854 3:68040690-68040712 TAGGTCTGGCAGAAGGAGGAAGG - Intronic
956696373 3:71922404-71922426 AATGAACTGTAGAAGGAGGAAGG + Intergenic
956906112 3:73767062-73767084 AAAGACTTGGCGAAGGAGGGTGG - Intergenic
956958783 3:74373815-74373837 ACTGACTGGTAGAAGAAGGAAGG + Intronic
956967506 3:74479075-74479097 ACTGTCTGGGGGAGGGAGGAAGG + Intronic
957225880 3:77445426-77445448 AATCACTGGGAGAGGGAAGTAGG - Intronic
958114345 3:89196026-89196048 AATGACTGGGAGAAGGAGGAAGG - Intronic
958708084 3:97681843-97681865 ACTGATTGGGAGAGGGATGAAGG + Intronic
959498989 3:107083920-107083942 GATAAGTGGGAAAAGGAGGAAGG + Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
959560323 3:107772341-107772363 AAGACCTGGAAGAAGGAGGAAGG - Intronic
959614502 3:108331944-108331966 AATGACTGGTACAAGCAAGATGG + Intronic
959918131 3:111841328-111841350 ATTGAGTAGGAGTAGGAGGAGGG + Intronic
960061512 3:113327469-113327491 AATAACAGGAAAAAGGAGGAGGG + Intronic
960088599 3:113616308-113616330 CATTAGTGGGAGAAGGAGCATGG + Intronic
960128951 3:114032648-114032670 AATGAGTGAGAGAAGGGGTAGGG - Intronic
962208058 3:133451859-133451881 AATGGGTGGGAGATGGAGAAGGG - Intronic
962260710 3:133901982-133902004 AATGACTGGGAGGGGTATGATGG - Intergenic
963116575 3:141735424-141735446 AAGGAAAGGGAGAAGGAGAAAGG - Intergenic
963239880 3:142992468-142992490 ACTGACTGGTAGAAGCAGAACGG - Intronic
963287549 3:143448005-143448027 AAAGAATGGGGGATGGAGGATGG + Intronic
963444936 3:145393259-145393281 AATGTGTGGAAGAAGCAGGAAGG - Intergenic
963880932 3:150527430-150527452 AATGAATCTGAGAAGGAGAATGG + Intergenic
964004967 3:151816172-151816194 AATGAGTGGGAGAAAAAGGGAGG - Intronic
964168674 3:153739813-153739835 AACGACAGGAAGAATGAGGAGGG + Intergenic
964453799 3:156838561-156838583 ACCAACTGGGAGAAGGAAGAAGG + Intronic
965566915 3:170129337-170129359 CATTACTGGGAGCTGGAGGAAGG + Exonic
966396327 3:179507405-179507427 AAGGAAGGGAAGAAGGAGGAAGG + Intergenic
966668695 3:182502178-182502200 AGGGACTTGGAGAAGGAGGAAGG + Intergenic
966928156 3:184658887-184658909 AAGGCCTGGGAGAGGGAGGAGGG - Intronic
967094581 3:186166658-186166680 AAAGACAGAGAGAAGGAGGAGGG + Intronic
967133482 3:186493977-186493999 AATCACTAGGAGAAGGGCGAGGG - Intergenic
967264444 3:187677970-187677992 GATGACAGGGAGAGGGAAGAAGG - Intergenic
967370506 3:188739589-188739611 AATTCCAGGGAAAAGGAGGAGGG + Intronic
968126380 3:196163584-196163606 AAGGACGGGTAGAAGGAAGAGGG - Intergenic
968293792 3:197557823-197557845 GAAGACTGGGAGAATCAGGAAGG + Intronic
968382737 4:109485-109507 AGTGCCTGGGAGAAGGAGGTGGG + Intergenic
968901227 4:3432826-3432848 AGTGAGTGGGAGAAGGAGGTGGG + Intronic
970059380 4:12013792-12013814 CATGACTTGGAGAAGTATGAAGG - Intergenic
970204760 4:13644757-13644779 ATTGACTGGGTGAAGCAGGAAGG + Intergenic
970634864 4:17997732-17997754 AAAAACTGGGAGAAAGAGGATGG + Intronic
970768581 4:19582331-19582353 AAAGAATGGGAAAATGAGGAAGG - Intergenic
970867772 4:20778989-20779011 AGAGACAGGGAGGAGGAGGAAGG + Intronic
970871028 4:20817116-20817138 AATCTCTGGGAGAGGAAGGAGGG + Intronic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
971865169 4:32160513-32160535 AAGGAAGGAGAGAAGGAGGAAGG - Intergenic
972311868 4:37890369-37890391 AAGGACGGGGAGAAGGGGTAAGG + Intergenic
972580279 4:40389170-40389192 AAGAACTGGGAGAAGAAAGATGG + Intergenic
972812847 4:42609412-42609434 CATGACTGTGAGCAGGAGAAAGG - Intronic
972865288 4:43224990-43225012 TATGACTGGAAGAAGAAGAAAGG + Intergenic
973317205 4:48774465-48774487 ACTGAATGGGAAAAGGAGGGTGG + Intronic
974323535 4:60385358-60385380 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
974400812 4:61403515-61403537 AAGGTATGGGAGAAGGAGCACGG - Intronic
974753773 4:66176784-66176806 AATGAGAAGGAGAAGGAGAAGGG + Intergenic
976230492 4:82837731-82837753 AATCACTGGGGGAAGGAAGAGGG + Intronic
976407540 4:84677289-84677311 GATCACTGGGTGAAGGATGAAGG - Exonic
976455078 4:85237057-85237079 AACTACTGGCAGAATGAGGATGG - Intergenic
976874520 4:89837160-89837182 GAGGACTAGGAGGAGGAGGACGG - Intronic
977350910 4:95885929-95885951 AATGAGTGGAAGCAGCAGGAGGG - Intergenic
978386458 4:108180385-108180407 AAAGAATTGGAGGAGGAGGAAGG + Intergenic
978875699 4:113637992-113638014 CATATTTGGGAGAAGGAGGATGG - Intronic
979481094 4:121218593-121218615 AGGGACGGGGAGAAGGAGGAAGG - Intronic
979520063 4:121655790-121655812 AAGGACTGGGAGCAGGAGAGAGG + Intergenic
979585040 4:122405316-122405338 AATGACTGGGTTAAGTAGAAAGG - Intronic
980670256 4:135995502-135995524 AATGAGAGAGAGATGGAGGAGGG - Intergenic
980784320 4:137532632-137532654 AAAGAGACGGAGAAGGAGGAAGG + Intergenic
980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG + Intergenic
980896968 4:138869084-138869106 AGAGAAGGGGAGAAGGAGGAGGG + Intergenic
982067531 4:151667613-151667635 AATGACCAGGAGAAGGTGGGTGG + Intergenic
982109810 4:152043859-152043881 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
982183617 4:152774039-152774061 AGGGATTGGGAGAGGGAGGAAGG - Intronic
982349682 4:154401050-154401072 AGTGACTGGGAGGAGGAACAAGG - Intronic
983367668 4:166815106-166815128 AATGACTGTTAGAATGAGTATGG + Intronic
983402492 4:167282558-167282580 AAAAACTGAAAGAAGGAGGAAGG + Intergenic
983513119 4:168630066-168630088 AATGCCTGGGCGAAAGAGGAAGG - Intronic
984429051 4:179625122-179625144 AGGCCCTGGGAGAAGGAGGAAGG - Intergenic
985950783 5:3220125-3220147 AATGGTTGGGGGATGGAGGAGGG - Intergenic
986279239 5:6309969-6309991 AATGAACAGGAGAAGGAGGTGGG - Intergenic
987055352 5:14185648-14185670 AATGATTGGGAGAAGACAGAGGG + Intronic
987218298 5:15762390-15762412 AATGCCTGGGAGCAGGATGAAGG + Intronic
987362996 5:17123383-17123405 AATGACTGGGGAAAAGAGGGAGG - Intronic
987925069 5:24330345-24330367 CATGACTGAGAACAGGAGGAAGG + Intergenic
988530538 5:32023336-32023358 CGTGGCTTGGAGAAGGAGGAAGG - Intronic
988912418 5:35856906-35856928 AATGAATGAGAGTAAGAGGAAGG - Exonic
989056342 5:37369470-37369492 AGAGACTGGGTGAAAGAGGAAGG + Intronic
989724774 5:44575101-44575123 AATGACAGAGAGATGGAGGATGG - Intergenic
989951426 5:50302776-50302798 AGTGAGTGGGAGAGGCAGGATGG - Intergenic
990091855 5:52061532-52061554 AGTGAATGAGAAAAGGAGGAAGG - Intronic
990136174 5:52646026-52646048 AAAGAAAGGGAGAAGGGGGATGG - Intergenic
990322334 5:54642144-54642166 AAGGTCTGAGAGAAGGAGGCTGG + Intergenic
990897928 5:60718826-60718848 AAAGAGTTGGAGAAGGTGGAAGG - Intergenic
991003347 5:61804736-61804758 AATCACTATGAGAAGAAGGAGGG - Intergenic
991185097 5:63797077-63797099 AATGAGGAGGAGGAGGAGGATGG + Intergenic
992181118 5:74199467-74199489 AGAGACTTGGAGAGGGAGGATGG + Intergenic
992280857 5:75175536-75175558 AATGACTGAGAGAGGCATGAGGG + Intronic
992606669 5:78464527-78464549 ATGGACTGCGAGAAGGATGAGGG - Intronic
992770582 5:80043592-80043614 CAGGACTGGGAGATGAAGGAGGG + Intronic
992829994 5:80584785-80584807 AGAGACTTGGAGAAGGAGGCAGG - Intergenic
993290978 5:86069706-86069728 ATAGACTGGGAGAAGTAGCATGG + Intergenic
993504944 5:88697232-88697254 AATGAATGGGAGGAAGAGAAAGG - Intergenic
993736257 5:91479859-91479881 CCTAACTGGGAGAAAGAGGATGG - Intergenic
993923952 5:93842540-93842562 AAAGACTAGGAGAACAAGGAAGG + Intronic
995458706 5:112379486-112379508 AATGACAGGGAAGAGGAGAAAGG + Intronic
995726615 5:115187668-115187690 ATTGACTTTGAGAAGCAGGAAGG + Intergenic
996241198 5:121204716-121204738 AATGCCTGGGGGAAGGGGAAAGG + Intergenic
997643110 5:135462658-135462680 AAAGACTGAGAAAGGGAGGAGGG - Intergenic
997799251 5:136843389-136843411 AGGGACGGGGAGAAGGAGAAGGG - Intergenic
997864404 5:137448368-137448390 GATGTTTGGTAGAAGGAGGATGG - Intronic
999825136 5:155266535-155266557 AATGACTAGGAGAAAAAGGTAGG - Intergenic
999889373 5:155960145-155960167 AATGAAGAGGAGAAGGAAGATGG - Intronic
1000667921 5:164021640-164021662 GATGAATGGGAGAAGAAAGAAGG + Intergenic
1000925975 5:167194606-167194628 AATGACGGTGAGAAGGAACAGGG + Intergenic
1000944886 5:167409334-167409356 AATGTCTGGGCTAAGCAGGATGG + Intronic
1001152683 5:169245910-169245932 TAGGACTGGGAGTAGGATGATGG - Intronic
1001480943 5:172088939-172088961 AAGGACTGGAACAGGGAGGAAGG - Intronic
1001626952 5:173144268-173144290 AATGCCTGACAGAAGGAAGATGG + Intergenic
1001887227 5:175303958-175303980 AATGAGTAGCGGAAGGAGGAAGG - Intergenic
1002089104 5:176794054-176794076 GATGACTGAGGGCAGGAGGAAGG - Intergenic
1002859081 6:1064192-1064214 CCTGACTTGGAAAAGGAGGAAGG - Intergenic
1003521677 6:6863440-6863462 CCTGACTGGAAGGAGGAGGAAGG - Intergenic
1004118775 6:12798178-12798200 AATGAATGAGGGAAGGAGAAAGG + Intronic
1004173547 6:13318290-13318312 CATGACTGGGAGACGTGGGATGG + Intronic
1004329472 6:14708389-14708411 ATTAATTGGGAGAAGGAGAAAGG - Intergenic
1004444974 6:15689607-15689629 AAGGACTGGGAGAAAGGGGAAGG - Intergenic
1004660791 6:17707199-17707221 ACCGACAGGGAGAAGGAGAATGG - Intergenic
1005035709 6:21553285-21553307 ATTGACTGGAAGAAGGGGAAAGG + Intergenic
1005475438 6:26203403-26203425 AATGGGAGGGAGAAAGAGGAAGG + Intergenic
1005769390 6:29051213-29051235 GACGAATGGGAGAAGGAGGGAGG - Intergenic
1006025747 6:31145577-31145599 AAGGACTGGTGAAAGGAGGAAGG + Intronic
1006434698 6:34020109-34020131 AATGACTGTTAGAATGAGGTGGG - Intronic
1006480368 6:34288076-34288098 AATGACTGGGAAATAGAGAAAGG + Exonic
1006817448 6:36862061-36862083 AGTGACTAAGAGGAGGAGGAAGG - Intronic
1007004536 6:38348061-38348083 AATGACTGAAAGTGGGAGGAGGG + Intronic
1007054967 6:38874112-38874134 AAAGAAAGAGAGAAGGAGGAAGG - Intronic
1007054972 6:38874155-38874177 AAAGAAAGAGAGAAGGAGGAAGG - Intronic
1007105661 6:39281382-39281404 TCTGACTGAGAGAAGGAGAAAGG - Intergenic
1007520128 6:42445610-42445632 AAAGATTGGGAGAGGGAGGCGGG - Intronic
1008090078 6:47284807-47284829 AAAAGGTGGGAGAAGGAGGATGG - Intronic
1008406994 6:51129466-51129488 AATGACTGCAAATAGGAGGATGG - Intergenic
1008501805 6:52190832-52190854 AATGACTGAGAGGAGGTGGCTGG - Intergenic
1008674717 6:53807273-53807295 AGTGAATGAGGGAAGGAGGAGGG - Intronic
1009920164 6:70048388-70048410 AATGAGTGGGTAAAAGAGGAAGG - Intronic
1010157381 6:72810652-72810674 TATGACTGCGAGTAAGAGGAGGG + Intronic
1011575022 6:88787845-88787867 AAAGACTTGGAGATGAAGGAAGG + Intronic
1011618422 6:89219493-89219515 AATAACAAGGAGAAGGAAGATGG + Intronic
1012526673 6:100185953-100185975 AAAGTCTAGGAGAAGAAGGAAGG - Intergenic
1012734315 6:102919713-102919735 AAGGAATGGGAGAAGAAGGAAGG + Intergenic
1012916182 6:105173542-105173564 AAATACTGGGGGCAGGAGGAAGG + Intronic
1013313984 6:108923926-108923948 AATGAGAAGGGGAAGGAGGAGGG - Intronic
1013496681 6:110704818-110704840 AATGAGAGGGAGATGGAGGGAGG + Intronic
1013851697 6:114523710-114523732 ATGGAATGGGAGAAGGTGGAAGG + Intergenic
1014171799 6:118287203-118287225 AATGACTGGGTGTGTGAGGAGGG - Intronic
1014801091 6:125778601-125778623 AATGCCTGAGAAAAGGAGAATGG - Intergenic
1015027495 6:128554069-128554091 GAAGAGAGGGAGAAGGAGGATGG - Intergenic
1015317458 6:131832470-131832492 AAGATCTGGGAGAAGGAGAAAGG + Intronic
1016026135 6:139288796-139288818 AATGGCCTGGAGAAGGAAGATGG - Exonic
1016804201 6:148196546-148196568 GCTCACTGGGAGAAAGAGGATGG - Intergenic
1017172015 6:151465720-151465742 AATGACTTGGGGAGGGAGGTTGG + Intronic
1018378934 6:163240233-163240255 GATGTCTGGGAGGAGGAGGGGGG + Intronic
1018601233 6:165544208-165544230 AATGACTTTGAGAAAAAGGAAGG - Intronic
1018619417 6:165715549-165715571 AATGAAGGGGAGAAGGAGGAGGG + Intronic
1018717206 6:166542711-166542733 AGTGACAGGGAGAAAGATGAGGG + Intronic
1019137887 6:169922526-169922548 GCTGCCTGGGAGGAGGAGGAAGG + Intergenic
1019151738 6:170010972-170010994 AAGGACAGAGGGAAGGAGGAGGG + Intergenic
1019353543 7:567053-567075 AACGACTGGGAGAAAGGGGTGGG + Intronic
1019682640 7:2360119-2360141 AATCACTGGGAACAGGAGGTGGG + Intronic
1020019056 7:4851326-4851348 AAGGACTCTGAGAAGCAGGATGG + Intronic
1020125794 7:5531866-5531888 AAGGAGGGGGAGGAGGAGGAAGG - Intronic
1020483587 7:8692864-8692886 AATGAATGTGACAAGGAAGAAGG + Intronic
1020917531 7:14214929-14214951 ATGGAGTGGGAGAAGGAGGGAGG - Intronic
1022574805 7:31487306-31487328 AAGGACAGGAGGAAGGAGGAAGG - Intergenic
1023260413 7:38353089-38353111 AAGGACGGAGGGAAGGAGGAAGG + Intergenic
1023777548 7:43622332-43622354 AATGAGTGGGAGGAAGAGGTTGG - Intronic
1023898047 7:44451318-44451340 AAAGACTGGGAGCACGGGGAAGG + Intronic
1024058702 7:45682650-45682672 TAGGACGGCGAGAAGGAGGATGG - Intronic
1024251416 7:47508492-47508514 AAGGACTGAGATAAGGAGAAGGG + Intronic
1024435440 7:49348265-49348287 AGTGAAGGGGAGAAGGAGGGTGG - Intergenic
1025120130 7:56294764-56294786 AATGGATGGATGAAGGAGGATGG + Intergenic
1026489033 7:70846856-70846878 AATGACAGGGGGCAAGAGGACGG - Intergenic
1026523336 7:71134392-71134414 AGGGGCAGGGAGAAGGAGGATGG + Intronic
1026624013 7:71976399-71976421 AATCTCTGGGAGAAGGAGCCAGG - Intronic
1027297828 7:76796266-76796288 AAGGACTTGGAGGAGGAGAATGG - Intergenic
1027464935 7:78503593-78503615 AAGGAGGGGGAGAAGGAGGAGGG - Intronic
1027509554 7:79062732-79062754 GATGACAGGGAGGAGGTGGAAGG - Intronic
1027591821 7:80127881-80127903 GAGGACTGGGAGTAGGAGGCAGG - Intergenic
1028231348 7:88309951-88309973 AATTACTGGGATATGAAGGATGG + Intergenic
1029004884 7:97198871-97198893 ATGCATTGGGAGAAGGAGGAGGG - Intergenic
1029090882 7:98047308-98047330 CATGAGAGTGAGAAGGAGGAGGG + Intergenic
1029208031 7:98880613-98880635 AATGGCTGGGGAAAAGAGGAAGG + Intronic
1029222225 7:98999658-98999680 AATGAAGGTGGGAAGGAGGATGG + Intronic
1029308643 7:99640817-99640839 AACTAATGGGAGAGGGAGGATGG + Intergenic
1029925156 7:104308177-104308199 AATGAGTAGGAGAAGGATTATGG + Intergenic
1030072196 7:105707444-105707466 AATGAGTGGGGGATGGAGGAAGG + Intronic
1030746688 7:113174002-113174024 AATGACTGGGAAGAGTATGAAGG - Intergenic
1030766823 7:113420633-113420655 TATTAATGGGAGAAAGAGGAGGG + Intergenic
1030849877 7:114470797-114470819 AAAAACATGGAGAAGGAGGATGG - Intronic
1030921285 7:115391772-115391794 AAAAATTGGGAGAAGGAGGCGGG - Intergenic
1030951340 7:115793783-115793805 AATGACTGAATGAAGGAGGTAGG + Intergenic
1031114199 7:117650052-117650074 AATGAGTCAGAGAAGTAGGAGGG + Intronic
1031346506 7:120673547-120673569 AATGATATGGAGAAGGAGGATGG - Intronic
1031476547 7:122230038-122230060 AGTGACTGGGAGAAAGAACAAGG - Intergenic
1032459219 7:132097197-132097219 AATGACGGGGAGCAGGAAGGAGG - Intergenic
1032890019 7:136183995-136184017 ATAGACTGAGAGAAAGAGGAAGG + Intergenic
1032934293 7:136711230-136711252 AAGGAGTGGGAGGAGGAGGAGGG + Intergenic
1033023781 7:137753530-137753552 ACAGAGTGGGAGCAGGAGGAGGG + Intronic
1033148027 7:138887905-138887927 AATGGCTGGGAGATGGTCGAGGG - Intronic
1033555619 7:142486457-142486479 AAACATTAGGAGAAGGAGGAGGG - Intergenic
1033560465 7:142525985-142526007 AACCATTAGGAGAAGGAGGAGGG - Intergenic
1033725436 7:144111172-144111194 AGTGACTGGGAGGGGTAGGAAGG + Intergenic
1034337378 7:150332251-150332273 ATTGGATGGGAGAAGAAGGAAGG + Exonic
1034422289 7:150996196-150996218 TGGGACGGGGAGAAGGAGGAAGG - Intronic
1034903906 7:154927336-154927358 AACCAGTGGGAGCAGGAGGAGGG + Intergenic
1035722044 8:1799288-1799310 AAGGAGGGGGAGGAGGAGGAGGG - Intergenic
1036239483 8:7070105-7070127 GAGGCCTGGGACAAGGAGGAAGG + Intergenic
1036594954 8:10203173-10203195 CATGAATTGGAGAAGGTGGAGGG - Intronic
1037591738 8:20318080-20318102 AATCACAGAGAGAAGGAAGAGGG - Intergenic
1037598979 8:20377886-20377908 AATGACTGAGTGAACGATGAAGG - Intergenic
1037806922 8:22063167-22063189 AGAGACTGGGAGAAGGGGAAAGG - Intronic
1037916557 8:22776736-22776758 TATGGATGGGAGAAGGAGAATGG + Intronic
1038153365 8:24962567-24962589 AATGACTGGGAGGAGGCACAAGG + Intergenic
1038356705 8:26835930-26835952 TTTGCCTGGGAGAAGGATGAAGG + Intronic
1038503447 8:28064053-28064075 GGTGAATGGGAGAAGGAGCATGG - Intronic
1038536177 8:28354190-28354212 AATGCCTCTGAGCAGGAGGACGG + Intronic
1038869272 8:31476374-31476396 CATTAATGGGAGATGGAGGATGG + Intergenic
1038970880 8:32633753-32633775 CAAGACTGAGAGAAAGAGGAAGG - Intronic
1038980364 8:32752690-32752712 AATGACAGAGAGACCGAGGAAGG - Intronic
1039319791 8:36415895-36415917 AATTACTGTAGGAAGGAGGATGG + Intergenic
1039691292 8:39867639-39867661 AAGGAGGGGGAGGAGGAGGAAGG - Intergenic
1040624660 8:49133323-49133345 AAGGAGGGGGATAAGGAGGAAGG + Intergenic
1040626865 8:49159504-49159526 AATGACTGGGAGTCAGATGAGGG - Intergenic
1040910855 8:52517350-52517372 AATGAGTGGGAGAAAGAAGAAGG - Intergenic
1041343781 8:56873976-56873998 AAGCAATGGGAGCAGGAGGATGG + Intergenic
1042319216 8:67457478-67457500 ACTGACTGGAGGAAAGAGGAAGG - Intronic
1042882928 8:73514291-73514313 ACTGACTGTGATGAGGAGGAAGG - Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043112453 8:76203365-76203387 AAGGACTCAGTGAAGGAGGAAGG - Intergenic
1044636095 8:94325793-94325815 AATGCCTGGGAAAAATAGGAAGG - Intergenic
1044651978 8:94505372-94505394 ATTTGCTGGGAGAAGGAAGAGGG - Intronic
1044801948 8:95966151-95966173 TAAGAGAGGGAGAAGGAGGAAGG + Intergenic
1045130012 8:99140624-99140646 AAGGAGGGGGAGGAGGAGGAAGG - Intronic
1045231391 8:100310128-100310150 AAGAAGTGGGAGGAGGAGGAGGG - Intronic
1045322014 8:101089292-101089314 AAGGATTGGGAGAAGGAAGGAGG + Intergenic
1045824434 8:106380116-106380138 TAGGACTGGGAGAAGGGGAAGGG - Intronic
1045971760 8:108086304-108086326 GATGCCTGAGAGAAGGAGGTAGG - Intergenic
1045987405 8:108264574-108264596 CATGGCTGAGAGCAGGAGGAAGG - Intronic
1046687332 8:117242221-117242243 TTTTACTGGGAGAAGGAGAAGGG - Intergenic
1046752595 8:117941054-117941076 AAGGAATGTGAGAAGCAGGATGG - Intronic
1046872032 8:119214431-119214453 AATAGCTATGAGAAGGAGGAAGG + Intronic
1047951601 8:129939827-129939849 AACGACGGGGAGGGGGAGGAGGG + Exonic
1048132574 8:131714000-131714022 CATCACTGGGGGAAAGAGGAAGG - Intergenic
1048165928 8:132061386-132061408 AGGGACAGAGAGAAGGAGGAAGG - Intronic
1048579753 8:135721159-135721181 AATGACCGAGTGATGGAGGAAGG + Intergenic
1048581308 8:135731717-135731739 AAAGGGTGGGAGGAGGAGGAAGG + Intergenic
1049022097 8:139964292-139964314 GATGTCTGGGAGAATGAGGCGGG + Intronic
1049058192 8:140255491-140255513 GATGGCTGGGAAAAGGATGATGG + Intronic
1049088238 8:140494315-140494337 AGTGACTGGGAGGAGGGAGAGGG - Intergenic
1049122033 8:140747676-140747698 AAGGAAGGGGAGGAGGAGGAGGG + Intronic
1049526547 8:143129752-143129774 CAGGGCTGGGGGAAGGAGGAGGG + Intergenic
1049582535 8:143419324-143419346 GGTGACAGGGAGAAGGAGCAAGG - Intronic
1049658408 8:143808964-143808986 GATGACAGGGAGATCGAGGAGGG - Exonic
1049726785 8:144150325-144150347 AACGAATGGGAGAAGGTGGCAGG - Intronic
1051106534 9:13587294-13587316 AATGACAGGAAGTAGGAAGATGG - Intergenic
1052014644 9:23450848-23450870 AGTGACTGGGAGAAGGATTGAGG - Intergenic
1052682780 9:31715613-31715635 AATGACTGGCACAAGGGGCAGGG + Intergenic
1052949899 9:34200058-34200080 AATTACTGGGAGCGGGGGGAAGG - Intronic
1053016954 9:34667314-34667336 AATGAGAGGGAGAAAGAGGGTGG - Intergenic
1053096552 9:35333545-35333567 GATGAAAGGGAGAAGGAGGAAGG - Intronic
1053104164 9:35396332-35396354 GATGGCTGTGAGAAGGAGGTTGG + Intronic
1053480548 9:38413437-38413459 AGTCAGTGGGAGGAGGAGGAAGG - Intronic
1053512538 9:38700879-38700901 AGTGACTCAGAGAAGGAGGCTGG - Intergenic
1053750585 9:41250517-41250539 GATGAATGAGGGAAGGAGGAGGG + Intergenic
1053771430 9:41482418-41482440 AAGGAGGGGGAGAAGGAAGAAGG - Intergenic
1054335216 9:63800752-63800774 GATGAATGAGGGAAGGAGGAGGG - Intergenic
1055284242 9:74711531-74711553 AATGCCTAGGAGAAGGAAGCGGG - Intergenic
1055540217 9:77296455-77296477 AATGACAGAAAGAAGGAAGAGGG - Intronic
1056218480 9:84428271-84428293 GATGAAGGGGAGAAAGAGGAGGG - Intergenic
1056741162 9:89256619-89256641 GAAGAATGGGGGAAGGAGGAAGG + Intergenic
1056897562 9:90565255-90565277 AGGGAAGGGGAGAAGGAGGAGGG - Intergenic
1057546864 9:96025522-96025544 GATGACTAGGAGTAGCAGGAAGG + Intergenic
1057703491 9:97381041-97381063 AAGGAATGGGAGAAGGGGCACGG - Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1058504681 9:105655979-105656001 AATGTGTTGGAGAAGGAGGTTGG + Intergenic
1058620678 9:106879527-106879549 ACAGACTGGGAGGAGGAGAAAGG + Intronic
1058741521 9:107947481-107947503 AATCACTGGGACCAGGGGGATGG + Intergenic
1059292143 9:113235658-113235680 CATGACTGGGAGAGGCAGGAGGG + Intronic
1059628929 9:116098685-116098707 AACGACTGAGAGATGGAGGTTGG - Intergenic
1059688729 9:116663097-116663119 AGTGATTGGAAGGAGGAGGAAGG - Intronic
1059723384 9:116983373-116983395 CATGACTAGTACAAGGAGGAAGG + Intronic
1060222836 9:121773562-121773584 AATGACCGAGAGGAGGAGCATGG - Intronic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1061650944 9:132049517-132049539 ACAGACTGGGAGCAGGAAGACGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062215829 9:135389321-135389343 AATGACAGTGAGAAGGAAGTAGG - Intergenic
1062282337 9:135757623-135757645 AATGGCTGGCAGGAGGAGGAGGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062721146 9:138044823-138044845 AGTGACTGGGGGGAGGAGGCAGG - Intronic
1185511232 X:666524-666546 CAGGACTGGGAGAGGCAGGAAGG + Intergenic
1185511253 X:666613-666635 CAGGACTGGGAGAGGCAGGAAGG + Intergenic
1185688218 X:1948093-1948115 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185688507 X:2133632-2133654 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185764661 X:2715730-2715752 AAAAGCTGGGAGAAGCAGGAAGG - Intronic
1186034478 X:5406171-5406193 AAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1186450370 X:9667693-9667715 AATGGCAGGGAAAAGGAAGAGGG + Intronic
1186675121 X:11808414-11808436 AAGGACAGTGAGAAGAAGGAAGG + Intergenic
1186720644 X:12300233-12300255 AATGACAAGGAGAAGGACAATGG + Intronic
1187029369 X:15469925-15469947 AGTGAGTGGCAGAAGGAGTATGG + Intronic
1187029846 X:15474717-15474739 TATGACTGGAGGAGGGAGGAAGG - Intronic
1187050300 X:15689182-15689204 ACTGACTGCGAGAAGCTGGAGGG - Intronic
1187172526 X:16866034-16866056 AATGACTGGGGAAAGGAAGTAGG + Intronic
1187616943 X:21006305-21006327 AAAGATTGGGAAAAGCAGGAAGG + Intergenic
1188218387 X:27508249-27508271 AAGGGATGGGAGAAGGAGCAGGG + Intergenic
1188627689 X:32306729-32306751 AATCACTGAAAGGAGGAGGAAGG - Intronic
1188642304 X:32521430-32521452 AATGATAGGGTGGAGGAGGATGG - Intronic
1189120617 X:38390508-38390530 GCTGACTGGGAGATAGAGGAAGG - Intronic
1189377621 X:40477959-40477981 AAAGGCTGGAAGAAGGTGGATGG - Intergenic
1189712796 X:43831549-43831571 GATGACTGAGAGAGGGAGGAAGG + Intronic
1189724402 X:43954179-43954201 AAAGAATGGGAGAAGAAGCATGG - Intronic
1189913532 X:45835309-45835331 AATTACTGGGAGACCGAGGCAGG - Intergenic
1189921248 X:45905040-45905062 AATAAATGGCTGAAGGAGGAAGG - Intergenic
1190035679 X:47021124-47021146 ACTGGCAGGGAGAAGAAGGAGGG - Intronic
1190095618 X:47477812-47477834 AATGACTGGTATAAGGAGTGAGG - Intronic
1190239254 X:48644598-48644620 AATAAGTAGGAGAAGGAGAAGGG - Intergenic
1190497026 X:51036529-51036551 AAAGACTGGAAGAATGGGGAGGG - Intergenic
1190567954 X:51750383-51750405 AATGACTGGGAGGCTGAGGTAGG - Intergenic
1190713745 X:53087569-53087591 AATGAGAGGGAGATGGAGGGAGG - Intronic
1191777097 X:64826511-64826533 AGGGACTGGGGGAAAGAGGAAGG + Intergenic
1192050067 X:67716644-67716666 AATGCCAGGCAGAAAGAGGATGG + Intronic
1192286708 X:69746067-69746089 AATAAGTGGGGGAAGGAAGAGGG - Intronic
1192307573 X:69978699-69978721 TATGACTGGGAGAGGGAATAGGG - Intronic
1192313337 X:70034004-70034026 AACAAATGGGAGAAAGAGGAAGG - Intronic
1192429846 X:71104454-71104476 AATGAATGGGAGCATCAGGAAGG - Intronic
1192576293 X:72245782-72245804 AATGACAGGGACTGGGAGGAAGG + Intronic
1194065513 X:89255871-89255893 AATGCCTGTCAGAGGGAGGATGG - Intergenic
1195237649 X:102917561-102917583 AATGACAGAGAGAAGGTGGGAGG + Intergenic
1195635390 X:107108431-107108453 AGTGAATGGCAGCAGGAGGAAGG + Intronic
1195698342 X:107683268-107683290 ATTTAGTGGGGGAAGGAGGAGGG - Intergenic
1196124222 X:112082347-112082369 AAGGAGAGGGAGAAGGAGGGAGG + Exonic
1196597609 X:117563559-117563581 AAGGACTAGGAGAAGTTGGAAGG - Intergenic
1197887115 X:131230132-131230154 AATGAGTGGGAGTAGGAGATGGG + Intergenic
1198133977 X:133728338-133728360 AATGAGAAGGAGAAGGAGAAAGG + Intronic
1198413819 X:136399129-136399151 ATTGAATGGGAGAAGCATGAAGG + Intronic
1198505559 X:137297691-137297713 AATGAATGGGTGAATGAGTAAGG - Intergenic
1198572194 X:137969951-137969973 GATGATAGGGAGAAGGAAGAGGG - Intergenic
1198585465 X:138115936-138115958 TATGACTGGGAAAAGGACTAAGG + Intergenic
1199760087 X:150898586-150898608 CATGGCTGGGAGCAGGCGGAGGG + Exonic
1200066802 X:153507859-153507881 GCTGACTGGAAGAAAGAGGAGGG + Intronic
1200538872 Y:4434087-4434109 AAAGAGTGTGAGAAGAAGGAGGG - Intergenic
1200719682 Y:6589966-6589988 AATGCCTGTCAGAGGGAGGATGG - Intergenic
1200985843 Y:9303263-9303285 AATGACTGGCAGCAGGGGGTGGG + Intergenic
1202124733 Y:21557632-21557654 AATGACTGGCAGCAGGGGGTGGG - Intergenic
1202154275 Y:21871748-21871770 AATGACTGGCAGCAGGGGGTGGG + Intergenic
1202195251 Y:22294442-22294464 AATGACTGGCAGCAGGGGGTGGG + Intergenic
1202232775 Y:22672414-22672436 GATGACTGGCAGCAGGAGGTGGG - Intergenic
1202310381 Y:23523744-23523766 GATGACTGGCAGCAGGAGGTGGG + Intergenic
1202560421 Y:26146850-26146872 GATGACTGGCAGCAGGAGGTGGG - Intergenic