ID: 958118735

View in Genome Browser
Species Human (GRCh38)
Location 3:89256850-89256872
Sequence GGTAATGAATCTGAATCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958118732_958118735 4 Left 958118732 3:89256823-89256845 CCAGGGAAAAATCACTTTATACC 0: 1
1: 0
2: 0
3: 12
4: 188
Right 958118735 3:89256850-89256872 GGTAATGAATCTGAATCTATAGG 0: 1
1: 0
2: 1
3: 10
4: 151
958118731_958118735 5 Left 958118731 3:89256822-89256844 CCCAGGGAAAAATCACTTTATAC 0: 1
1: 0
2: 5
3: 30
4: 216
Right 958118735 3:89256850-89256872 GGTAATGAATCTGAATCTATAGG 0: 1
1: 0
2: 1
3: 10
4: 151
958118728_958118735 28 Left 958118728 3:89256799-89256821 CCATGGGTAACATAGTGAAAATA 0: 2
1: 0
2: 3
3: 61
4: 752
Right 958118735 3:89256850-89256872 GGTAATGAATCTGAATCTATAGG 0: 1
1: 0
2: 1
3: 10
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958118735 Original CRISPR GGTAATGAATCTGAATCTAT AGG Intronic
905222278 1:36456613-36456635 GGTCTTGAATCTCTATCTATTGG + Intronic
907488625 1:54794562-54794584 GGAACTGACTCTGAATCTAGAGG - Intronic
908903018 1:68978042-68978064 GGTAAAGAATCTAAATGTGTGGG - Intergenic
909922209 1:81396241-81396263 GGTAATGATTTTGTAGCTATTGG + Intronic
909927179 1:81451272-81451294 GGTAATGACTTTGACTCTAGAGG - Intronic
911047441 1:93639972-93639994 GCCAATGAATCTGAACCTACTGG + Intronic
911793062 1:102042843-102042865 GGTAATAAATTTGAATTCATTGG - Intergenic
914806092 1:150992994-150993016 GGTAATGAGTCTAAATGAATTGG + Intronic
916879019 1:169000800-169000822 TGTTCTGAATCTGAATCTTTGGG - Intergenic
917590986 1:176476780-176476802 GGTTATGATTCTGTATGTATAGG + Intronic
917740662 1:177959109-177959131 GGTAATGAGTCTATAGCTATAGG + Intronic
920695347 1:208177812-208177834 GCTAATGAATCAGAAACTCTGGG + Intronic
921286270 1:213612158-213612180 CCTACTGAATCTGAATCTCTGGG + Intergenic
923577194 1:235170115-235170137 TGTAATGAATATGAATCAACTGG - Intronic
1066671203 10:37842105-37842127 GTTAATGAAACTGTGTCTATGGG + Intronic
1068721389 10:60250265-60250287 GTTAATGATTCAGAATCTATGGG + Intronic
1070512151 10:77171194-77171216 TGTACTGAATCTGAAACTCTGGG + Intronic
1071683035 10:87726752-87726774 GATAATTGATATGAATCTATGGG - Intronic
1071782331 10:88860152-88860174 AGTAATGAATCAGAATCTCTAGG + Intergenic
1074478825 10:113799597-113799619 TTAAATGAATCTGAATCTCTAGG + Intergenic
1074935347 10:118173284-118173306 AGTAATGTATCTGAATATAAAGG + Intergenic
1075171861 10:120122842-120122864 ACTATTGAATCTGAATCTCTGGG - Intergenic
1075463994 10:122637804-122637826 GCTAATGAAGCTGAAGCTTTTGG - Intronic
1076879651 10:133233803-133233825 AATAATGAATCTGAATACATGGG + Intergenic
1078799355 11:14627386-14627408 TTTAATGAATCAGAATCTCTGGG + Intronic
1078989212 11:16628680-16628702 TGCAATGAATCTGAATCTGTAGG + Intronic
1079653229 11:22957309-22957331 ACTAATGAATCTGAATGTCTTGG - Intergenic
1079769140 11:24436776-24436798 AGTGATGAATCAGAATCTTTTGG + Intergenic
1087822555 11:102728796-102728818 GCTACTGAATCAGAATCTCTGGG + Intergenic
1088383967 11:109231056-109231078 AGTAATTAAATTGAATCTATAGG - Intergenic
1090945662 11:131427271-131427293 GATAAAAAATCTGAATCTTTAGG + Intronic
1092095736 12:5840449-5840471 GGGAATGAAGCTGCATATATTGG + Intronic
1093814501 12:23528594-23528616 TGTAGTGAATCAGAATCTCTGGG - Intergenic
1094632230 12:32187371-32187393 GGTTTTGAAAATGAATCTATGGG + Intronic
1097598275 12:61661498-61661520 GGCAATGTATCAGAATCTCTGGG - Intergenic
1097623251 12:61967219-61967241 GGTGATGAATCAGTATCTCTTGG - Intronic
1097629255 12:62039852-62039874 GCTACTGAATCAGAATCTCTGGG - Intronic
1098826124 12:75299285-75299307 GATAATAAATTTGTATCTATGGG - Intronic
1099296293 12:80832380-80832402 GGTATTGAATCTGTCTCTACAGG - Intronic
1099378222 12:81920405-81920427 GGAAATGACTCTGAATTTAATGG + Intergenic
1105407348 13:20143284-20143306 GGTTAGGAATCTGAAGCAATGGG - Exonic
1105904491 13:24792936-24792958 GGACATTAATCTGAATCTTTTGG - Intronic
1109541607 13:63785511-63785533 GACAATGAATCAGAATCTCTGGG + Intergenic
1110537567 13:76669474-76669496 GTAAATGAATCAGAATCTCTGGG - Intergenic
1110589539 13:77239499-77239521 CCTAATGAATCAGAATTTATGGG - Intronic
1113309359 13:109115609-109115631 TTTAATGAATCTTAATTTATTGG + Intronic
1115539793 14:34409847-34409869 GGTCAGGAATTTGAGTCTATTGG - Intronic
1115705086 14:35990321-35990343 GGTCAGGAACCTGAATATATTGG + Intergenic
1116560643 14:46374759-46374781 GGTAATGTACCAGAATCTCTGGG - Intergenic
1117910335 14:60631732-60631754 GGTAATGAAGTTGAATCAAAAGG - Intergenic
1122776792 14:104120569-104120591 GGTCCTGAATCTGCAGCTATGGG + Intergenic
1125009947 15:34860855-34860877 CCTTCTGAATCTGAATCTATAGG - Intronic
1125345824 15:38717645-38717667 GGGAATGAATCTCAATTTATTGG + Intergenic
1127285816 15:57532838-57532860 GGTTATGAATAACAATCTATTGG - Intronic
1127401516 15:58591386-58591408 AGTAATGAATCAGCTTCTATAGG + Exonic
1134197950 16:12173524-12173546 GGTCTTGAATCTGTATCTTTTGG + Intronic
1136914122 16:34165427-34165449 GGTAATGAATTTAAATATTTAGG + Intergenic
1137332213 16:47509875-47509897 GGGACTGAGTCTGAACCTATAGG - Intronic
1138791118 16:59905187-59905209 GGTAATCAATCTGAATAACTCGG - Intergenic
1141576672 16:84968406-84968428 GGCAATGAATCTGAATTTCAAGG + Intergenic
1142404010 16:89876381-89876403 GGTTATGAATGTGAATGCATTGG + Intronic
1144247364 17:13380533-13380555 GGTAAATAATATGAATCTCTTGG - Intergenic
1145102858 17:20091188-20091210 GGGAAAGAATCTGAGGCTATTGG + Intronic
1146841228 17:36155963-36155985 TGTAATGAACATGAATTTATAGG + Intergenic
1151922894 17:77171033-77171055 TGTAATGAATTTGAATTTTTTGG + Intronic
1156022929 18:32620387-32620409 ACTTATGAATCTGAATCTGTGGG + Intergenic
1158848484 18:61469964-61469986 GGTAAGAAATCTGAACATATAGG - Intronic
1159076937 18:63691027-63691049 GATAATGTATCAGAATCTCTGGG + Intronic
1159085318 18:63783324-63783346 AGTACTGAATCAGAAACTATGGG + Intronic
925560450 2:5186733-5186755 TATAATAAATCTGAATTTATAGG + Intergenic
930746575 2:54889816-54889838 GGTAATTATCCTGACTCTATTGG + Intronic
931994892 2:67830418-67830440 GTAAATGAATCAGAATCTCTGGG - Intergenic
933419072 2:82024380-82024402 GCTAATGACTCTCAATCCATAGG - Intergenic
933720942 2:85397301-85397323 CCTAGTGAATCAGAATCTATGGG + Intronic
938922893 2:136011376-136011398 GATCATGAAACTGCATCTATGGG - Intergenic
941750764 2:169133327-169133349 AGTAATGAATGTGAAAATATAGG - Intronic
942503221 2:176614213-176614235 GGAAATGATTCTGAAGCCATAGG - Intergenic
948012551 2:234661574-234661596 TTTAATGAATGTGAATCTTTAGG + Intergenic
1171909030 20:30923999-30924021 GGTAATGAATTTAAATATTTAGG + Intergenic
1175360281 20:58404769-58404791 ATTAATGAATCAGAATCTCTAGG - Intronic
1176661648 21:9641392-9641414 GGTAATGAATTTAAATATTTGGG - Intergenic
1177000745 21:15609259-15609281 CATAATGAATAGGAATCTATTGG - Intergenic
1184891802 22:47384199-47384221 GGTAAGGAAGCCGAATGTATGGG + Intergenic
951928821 3:27940695-27940717 GCAATTGAATCTGAATCTCTGGG + Intergenic
953533672 3:43760134-43760156 GATAAGGAAACTGAATCTAAGGG - Intergenic
956206148 3:66756792-66756814 AGAAATGAATCTGCATATATAGG + Intergenic
956505101 3:69929482-69929504 GCTAATGAATCAGAATCTCTGGG - Intronic
956626225 3:71269479-71269501 AGTAATGAAACTGAATCAACTGG - Intronic
956956731 3:74349938-74349960 GTTAATGAATCTGAATGTGCTGG - Intronic
957115588 3:76020368-76020390 GGTAATGAATCCAAATATAACGG - Intronic
957628981 3:82694097-82694119 GCTAATGAAGCTGAAGCTTTGGG + Intergenic
958118735 3:89256850-89256872 GGTAATGAATCTGAATCTATAGG + Intronic
958744606 3:98117146-98117168 GGAAATCAATATGAATCAATGGG - Intergenic
958917433 3:100065193-100065215 CTTACTGAATCTGAATCTCTGGG + Intronic
959088991 3:101882144-101882166 GGTAATAAATATAAATCAATGGG - Intergenic
962093103 3:132265992-132266014 GCTACTGAATCTGAAACTCTGGG - Intronic
964434523 3:156637497-156637519 GGTTATAAATCTGAATTTTTAGG + Intergenic
965106125 3:164356803-164356825 GGTAATGTGTCTGGATCTCTAGG - Intergenic
967169973 3:186815458-186815480 AATAATGAATCAGAATCTGTAGG + Intergenic
967230464 3:187333095-187333117 CCTACTGAATCTGAATCTTTTGG - Intergenic
967410424 3:189161394-189161416 TGTAATGTATTTGAATCTTTTGG - Intronic
975496326 4:75039570-75039592 CCTACTGAATCTGAATCTATGGG - Intronic
981610245 4:146586063-146586085 CCTAATGAATCAGAATCTCTAGG + Intergenic
984035573 4:174663793-174663815 GGTAATGACTCTGAATCCATGGG - Intronic
984829658 4:183960290-183960312 GGTAATGCTTCTGAATCTTTGGG + Intronic
985301814 4:188498160-188498182 TGTAGTGAATCTGAGTCTTTTGG + Intergenic
985413747 4:189715154-189715176 GGTAATGAATTTAAATATTTGGG + Intergenic
986742227 5:10714137-10714159 GGTAAAGATTCTTAATCTAATGG + Intronic
986877718 5:12131851-12131873 GCTAATGATACTGAATCTACAGG + Intergenic
987444027 5:17994046-17994068 TTAAATGAATCTGAATCTCTGGG - Intergenic
987526215 5:19053345-19053367 CCTACTGAATCTGAATCTCTGGG + Intergenic
988142892 5:27265903-27265925 GTTTATGAATTTAAATCTATTGG - Intergenic
991098437 5:62764379-62764401 GCTAATGAATCTGAATTTCCAGG - Intergenic
993643828 5:90438088-90438110 AATAATGAATTTGAATCTTTGGG - Intergenic
993792712 5:92226184-92226206 GGTTTTAAATCTGCATCTATTGG + Intergenic
995523180 5:113030032-113030054 GGTAATGTATTTGATTCTTTGGG + Intronic
998772487 5:145562117-145562139 AGTAATGAATCAGAATCTAGTGG + Intronic
1000163534 5:158624856-158624878 TGTAATGAATCAGAAACTCTGGG - Intergenic
1004609839 6:17229609-17229631 GGTAACGAAGCTTAATCTTTAGG - Intergenic
1007527666 6:42510940-42510962 GGTAAGGATTCTGTATTTATAGG + Intergenic
1008845493 6:55957976-55957998 GCTACTGACTCTGAATCTAGGGG + Intergenic
1010706376 6:79116379-79116401 TGTTCTGAATCTGTATCTATTGG - Intergenic
1012115504 6:95292279-95292301 GGGAATGACTCTGAATTTATTGG - Intergenic
1012439687 6:99251934-99251956 GTGAATGAATGTGAATCTGTTGG + Intergenic
1015564505 6:134553899-134553921 GTTAATGAAGCTGAAGCTTTAGG - Intergenic
1016801875 6:148177081-148177103 GGTAATTAATGTGAATCAACTGG - Intergenic
1020572171 7:9878036-9878058 GGTTATTAATCTGATTATATCGG + Intergenic
1020829981 7:13083219-13083241 AGTAATGGATCTGAAATTATGGG - Intergenic
1020895356 7:13932424-13932446 GATACTGTATTTGAATCTATTGG - Intronic
1021095733 7:16533711-16533733 TGTAATGGCTCTGAATCTCTTGG + Intronic
1021713637 7:23441107-23441129 TGTCATGACTCTGAATATATAGG - Intronic
1022069126 7:26893659-26893681 ACTAATGAATCAGAATCTCTGGG + Intronic
1026266746 7:68801939-68801961 GCTACTGAATCAGAATCTCTGGG - Intergenic
1028607353 7:92669736-92669758 AGTAATGAATCAGAATCTCAAGG + Intronic
1028736115 7:94214212-94214234 GACACTGAATCTGAATCTGTGGG + Intergenic
1029794488 7:102879645-102879667 GCTATTGAGTCTGAATCTTTAGG - Intronic
1030137445 7:106269014-106269036 GGTACTGAATATGTATCTGTTGG + Intronic
1030856622 7:114565501-114565523 TCTTATGAATCTGAATCTCTAGG + Intronic
1032826564 7:135575462-135575484 GGAAATGAAACTGAAACTATAGG + Intronic
1035585526 8:770146-770168 GCAAATGAATCTGAATAAATAGG - Intergenic
1035776705 8:2193646-2193668 GGTGTTGAATCTGAATCATTTGG + Intergenic
1039292133 8:36108267-36108289 CCTTATGAATCTGAATCAATAGG - Intergenic
1041972327 8:63758234-63758256 GATAATGTAGCTGAATCTCTGGG - Intergenic
1042015025 8:64299374-64299396 GGTAATCTGTCTGAATCTAGAGG - Intergenic
1043783819 8:84371131-84371153 TGTAATGAATCTGCTTCTACAGG - Intronic
1045793251 8:106011331-106011353 AGGAATGAATCTGAAAATATTGG - Intergenic
1049955935 9:693026-693048 GGTAATGAATTTAAATCATTAGG + Intronic
1050146618 9:2574976-2574998 AGTAATGATTCTGAGTCTCTAGG - Intergenic
1060350453 9:122853930-122853952 GGTAAAGAAACTGAACCTTTCGG - Exonic
1062298006 9:135844415-135844437 GGTAATGTACCAGAATCTCTGGG + Intronic
1203639210 Un_KI270750v1:143235-143257 GGTAATGAATTTAAATATTTGGG - Intergenic
1188184683 X:27099256-27099278 GGTACTGAGGCTGCATCTATGGG + Intergenic
1190281474 X:48933923-48933945 AGAAATGAATGAGAATCTATCGG + Intronic
1191129007 X:56988515-56988537 TGTAATGAATCAAAATCTCTTGG - Intronic
1191934380 X:66410709-66410731 GCTAATTAATCAGAATCTCTGGG + Intergenic
1192267407 X:69548246-69548268 TGAATTGAATCTGAATCTCTGGG - Intergenic
1193321842 X:80131912-80131934 TGAAATGAATCAGAATGTATGGG + Intergenic
1194186950 X:90782620-90782642 GTTAATGAATTTGAACATATTGG + Intergenic
1194511252 X:94797941-94797963 TGGAATGAAATTGAATCTATAGG + Intergenic
1197478687 X:126954995-126955017 GGTAATCAAGCAGATTCTATTGG - Intergenic
1200884927 Y:8258223-8258245 AGAAATTATTCTGAATCTATCGG + Intergenic
1201196808 Y:11502370-11502392 TGTAATCAATCTGAATGGATTGG + Intergenic
1202113751 Y:21450672-21450694 GCTAATGACTCCCAATCTATAGG + Intergenic