ID: 958119384

View in Genome Browser
Species Human (GRCh38)
Location 3:89264220-89264242
Sequence CTGCTTCCTAAACACAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 525
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 469}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958119384 Original CRISPR CTGCTTCCTAAACACAATGC TGG Intronic
902441115 1:16430676-16430698 AAGCTTCCCAAAAACAATGCTGG - Intronic
903150509 1:21404763-21404785 GTGCTTTCTAAATACAATGGTGG + Intergenic
904436972 1:30505342-30505364 GTGCTTCCAAAATACAATGGTGG - Intergenic
905105403 1:35560762-35560784 CTGCTGCCGAGACACAGTGCTGG + Exonic
905270699 1:36785662-36785684 CTGCCTCCTCAACAGAAAGCAGG - Intergenic
905737687 1:40341341-40341363 CTGCTTCCAAAATACGATACTGG + Intergenic
907586341 1:55621104-55621126 TTACTTCCTAGACACAATGAGGG - Intergenic
907625038 1:56021776-56021798 TTACTTCCTAAATACAATGGGGG + Intergenic
907685705 1:56609344-56609366 TTGCTTCCTACATACAATGGGGG + Intronic
907874357 1:58471481-58471503 CTGCCACCTAAACAAAATGAAGG + Intronic
907984269 1:59515318-59515340 TTACTTCCTAGATACAATGCGGG - Intronic
908927158 1:69269796-69269818 ATGCTTCCAAAATACAATGGTGG + Intergenic
909057116 1:70834159-70834181 TTACTTCCTAGATACAATGCGGG - Intergenic
909063527 1:70905671-70905693 TTGCTTCCTAGATACAATGAGGG - Intronic
909086129 1:71172060-71172082 TTGCTTCCTAGATACAATGGGGG + Intergenic
909250325 1:73344819-73344841 TTACTTCCTAGATACAATGCTGG - Intergenic
909269096 1:73600462-73600484 TTACTTCCTAGACACAATGGGGG + Intergenic
909579858 1:77221989-77222011 TTACTTCCTAAATACAATGGGGG + Intergenic
911246038 1:95518666-95518688 CTGCTTTCCAAACACAGTTCAGG - Intergenic
911275075 1:95850398-95850420 CTACTTCCTAGATACAATGAAGG - Intergenic
911803014 1:102167928-102167950 GTGCTTCCAAAATACAATGGTGG - Intergenic
911812183 1:102296522-102296544 TTACTTCCTAGAAACAATGCAGG - Intergenic
912042750 1:105412083-105412105 TTACTTCCTACACACAATGGGGG - Intergenic
912093254 1:106108094-106108116 GTGCTTCCAAAATACAATGGTGG - Intergenic
913383988 1:118239706-118239728 CTACTTCCTAGATACAATGAAGG - Intergenic
913611455 1:120513459-120513481 CTGCTTATTAAACACACAGCAGG + Intergenic
914579737 1:149008780-149008802 CTGCTTATTAAACACACAGCAGG - Intronic
915710841 1:157896733-157896755 CTACTTCCTAGATACAATGGAGG + Intronic
915752453 1:158224324-158224346 TTGCTTCCTAGAAACAATGGGGG - Intergenic
915856077 1:159387588-159387610 TTACTTCCTAGACACAATGGGGG - Intergenic
917066511 1:171100493-171100515 CTTCTTCCAAAATACAATGGTGG - Intronic
917219933 1:172717779-172717801 TGGCTTCATAAACACATTGCTGG - Intergenic
917637897 1:176954944-176954966 CTGCTTCCTAGAAAGAATGAAGG + Intronic
918238216 1:182600128-182600150 CTGCTTCCCAAACAGGCTGCTGG + Exonic
918493609 1:185109718-185109740 CTGCTCCCTAAATACAATGGTGG + Intergenic
919130336 1:193442597-193442619 CTGCTTCCTAGACACACTGCAGG - Intergenic
919412947 1:197269142-197269164 GTGCTTCATAAACACACAGCTGG - Intronic
920049847 1:203157248-203157270 ATGCTTCCAAAATACAATGGTGG + Intronic
920196778 1:204233129-204233151 CTGCTTTCAAAATACAATGGTGG - Intronic
921727560 1:218540154-218540176 GTGCTTCCAAAATACAATGGTGG - Intergenic
1062881336 10:980534-980556 CTGCATGCTTAACACCATGCAGG + Intergenic
1063284901 10:4676227-4676249 CTGCTTCCAAAACACAATGGTGG - Intergenic
1063310312 10:4945825-4945847 TTACTTCCTAGACACAATACGGG - Intronic
1063782550 10:9342802-9342824 ATCCTTCCAAAACATAATGCTGG + Intergenic
1063917483 10:10898154-10898176 CTGCTTCCAAAATACAATGGTGG - Intergenic
1063979184 10:11440097-11440119 TTGCTTCCTATACATAAAGCTGG + Intergenic
1065601965 10:27378206-27378228 TTGCTTTCTGAACACACTGCAGG + Intergenic
1066273227 10:33843984-33844006 TTGCTTCCTAGATACAATGGGGG + Intergenic
1066454332 10:35560046-35560068 CTGCTTCTAAAATACAATGGTGG - Intronic
1067050150 10:43011107-43011129 TTGCTTCCAAAATACAATGGTGG - Intergenic
1067162359 10:43838133-43838155 GTGCTTCCAAAATACAATGGTGG + Intergenic
1067562055 10:47311059-47311081 CTGCTTCCTGTACACACGGCAGG + Intronic
1067837206 10:49648976-49648998 CTGCTTCCAAATCCCAAGGCTGG + Intronic
1068221629 10:54052548-54052570 CTACTTCCTAGATACAATGAGGG - Intronic
1068400221 10:56518642-56518664 TTACTTCCTAGACACAATGGGGG + Intergenic
1068487426 10:57677888-57677910 TTACTTCCTAAATACAATGGAGG + Intergenic
1068604578 10:58990795-58990817 TTACTTCCAAAACACAATGGGGG - Intergenic
1069173513 10:65262238-65262260 TTACTTCCTAAATACAATGGGGG + Intergenic
1069730560 10:70609100-70609122 GTGCTTCCAAAATACAATGGTGG - Intergenic
1070654041 10:78258785-78258807 GTGCTTCCAAAATACAATGGTGG - Intergenic
1071164285 10:82786485-82786507 ATGCTTCCAAAACACAATGGGGG - Intronic
1072058180 10:91781677-91781699 CTGCTTCCAAAATACACTGATGG + Intergenic
1072161712 10:92773021-92773043 CTGCTTTATAAAGATAATGCAGG + Intergenic
1073603865 10:104873573-104873595 CTGCATCCAAAAGAGAATGCTGG - Intronic
1074807543 10:117068362-117068384 CTGGTTCCTAAATGCAGTGCAGG - Intronic
1075290701 10:121228262-121228284 CTACTTCCAAAATACAATGGTGG + Intergenic
1075500794 10:122971832-122971854 CTACTTCCAAAACACAATAGTGG - Intronic
1075543573 10:123336785-123336807 TTACTTCCTAGATACAATGCGGG + Intergenic
1077827560 11:5827066-5827088 TTACTTCCTAGATACAATGCGGG - Intronic
1078326991 11:10389001-10389023 TTGCTTCCTAGACAGAATGTAGG + Intronic
1079461288 11:20680523-20680545 CTGCTTCCAAAATACAATGGCGG + Intronic
1080129005 11:28770932-28770954 CTACTTCCAAAACGCAATGGTGG - Intergenic
1080131564 11:28801660-28801682 CTGCTCCCAAAATACAATGGTGG + Intergenic
1080973233 11:37303604-37303626 TTACTTCCTAAATACAATGGGGG + Intergenic
1081013340 11:37843941-37843963 ATGCTTCTAAAACACAATGATGG + Intergenic
1081182349 11:39999469-39999491 CTGCTTCCAAATCAAATTGCAGG - Intergenic
1082930896 11:58603857-58603879 CTGATTCCAAAAAACAATGGTGG - Intronic
1085291333 11:75402021-75402043 CTACCACCTACACACAATGCAGG - Intronic
1085588303 11:77732295-77732317 TTGCTTCCTAGATACAATGGGGG - Intronic
1086576212 11:88341515-88341537 CTACTTCCTAGATACAATGGTGG + Intergenic
1087571868 11:99937996-99938018 CTACTTCCAAAACAGAAAGCAGG - Intronic
1087763759 11:102128005-102128027 TTACTTCCTAGATACAATGCGGG - Intronic
1088252323 11:107871631-107871653 CTGCTTCCAAAATACAATGATGG - Intronic
1089001794 11:115058105-115058127 GTGCTTCCAAAATACAATGGTGG - Intergenic
1089008722 11:115114578-115114600 CTGCTTCCCAGCCAAAATGCAGG - Intergenic
1089187476 11:116629290-116629312 CTGCTTCCAAAATAAAATCCAGG + Intergenic
1089942311 11:122431286-122431308 ATGCTTCCAAAACACAATGGTGG - Intergenic
1090595272 11:128314601-128314623 TTGCTTCCAAGATACAATGCGGG + Intergenic
1090727295 11:129539492-129539514 CTACTTCCTAGATACAATGGGGG + Intergenic
1091235166 11:134017087-134017109 GTCCTTCTTAAACACAAGGCAGG + Intergenic
1091554027 12:1558494-1558516 GTGCTTCCAAAATACAATGGTGG + Intronic
1092903315 12:13080067-13080089 CTACTTTCTAAAGACAAAGCTGG - Intronic
1093113450 12:15180805-15180827 CTGCTTCCTACTCACAAAGCTGG - Intronic
1093411785 12:18876891-18876913 CTGCTTCCTGAACTGAATGCAGG + Intergenic
1093412314 12:18881212-18881234 CTGCTTCCTAAACAGGAAGAAGG - Intergenic
1094063452 12:26339667-26339689 CTGCTTCCTAACCACACAGAGGG - Intronic
1094422076 12:30281077-30281099 CTACTTCCTAGATACAATGGGGG - Intergenic
1095640790 12:44483102-44483124 TTACTTCCTAGACACAATGCAGG + Intergenic
1095929814 12:47614152-47614174 GTGCTTCCAAAATACAATGGTGG + Intergenic
1096935530 12:55269378-55269400 TTACTTCCTAGACACAATGGGGG - Intergenic
1097329085 12:58313512-58313534 TTCCTTCCTCAACAAAATGCTGG - Intergenic
1098203615 12:68083346-68083368 CTACTTCCTAGATACAATGGGGG + Intergenic
1098660449 12:73087251-73087273 TTACTTCCTAAATACAATGGGGG + Intergenic
1098676432 12:73294924-73294946 CTACTTCCTAGATACAATGGTGG - Intergenic
1098741481 12:74178693-74178715 CTACTTGCTAAATACAATGGGGG + Intergenic
1099445460 12:82746542-82746564 CTGCCTCCAAAACACATTGTAGG + Intronic
1099760373 12:86912877-86912899 TTACTTCCTAAATACAATGTGGG - Intergenic
1099778565 12:87165477-87165499 TTGCTTCCTAGATACAATGGGGG + Intergenic
1100593570 12:96052211-96052233 GTGCTTCCGAAATACAATGATGG - Intergenic
1102519369 12:113469225-113469247 CTGCTTGTTACACACCATGCAGG + Exonic
1106239830 13:27902646-27902668 CTTCTTCCTATCCACCATGCAGG + Intergenic
1106331210 13:28741343-28741365 CTGCTTACTGAACACAGTGTGGG + Intergenic
1106444251 13:29810788-29810810 CTTCTTCCTAAGCAGAGTGCTGG - Intronic
1107900473 13:45008130-45008152 CTGTTTCCTTAAAACAATCCTGG - Intronic
1108270682 13:48756473-48756495 CTACTTCCTAGATACAATGGGGG - Intergenic
1109276083 13:60306035-60306057 TTACTTCCTAAATACAATGAGGG + Intergenic
1109455321 13:62580080-62580102 CTTCTTCCCAAACACCATGAAGG - Intergenic
1110084653 13:71363460-71363482 CTACTTCCAAAATACAATGGTGG + Intergenic
1110157941 13:72341511-72341533 TTACTTCCTAAATACAATGCGGG - Intergenic
1110487987 13:76068762-76068784 TTGCTTCCTAGATACAATGGAGG - Intergenic
1110496416 13:76173665-76173687 TTACTTCCTAGATACAATGCAGG + Intergenic
1111206181 13:85013811-85013833 CTACTTCCAAAATACAATGGTGG - Intergenic
1111614236 13:90643461-90643483 TTACTTCCTAGATACAATGCAGG + Intergenic
1112101780 13:96197641-96197663 CTACTTCCTAGATACAATGAGGG + Intronic
1112598713 13:100833611-100833633 CTGCCTGCTAGACACAAAGCAGG - Intergenic
1112855742 13:103767937-103767959 TTACTTCCTAGATACAATGCAGG + Intergenic
1112882441 13:104123860-104123882 TTGCTTCCTAGATACAATGGGGG - Intergenic
1112884075 13:104147418-104147440 GTGCTTCCAAAATACAATGATGG + Intergenic
1112996193 13:105577787-105577809 GTGCTTCCAAAATACAATGATGG + Intergenic
1113449981 13:110402276-110402298 GTGCTTCCAAAATACAATGGTGG + Intronic
1113498224 13:110750742-110750764 CTGCTTCAGCAACACAATTCTGG - Intergenic
1113618763 13:111699100-111699122 CTGCCTCCTAAACACAGCCCCGG - Intergenic
1113624292 13:111784361-111784383 CTGCCTCCTAAACACAGCCCCGG - Intergenic
1114149355 14:20019266-20019288 CTGCATCTTAAAAACAATTCAGG + Intergenic
1114217061 14:20664923-20664945 TTACTTCCTAGACACAATGGGGG + Intergenic
1114812615 14:25917890-25917912 CTACTTCCTAGAGACAATGGGGG - Intergenic
1114833932 14:26180521-26180543 TTGTTTCCTAAACAAAATGATGG - Intergenic
1115321190 14:32080787-32080809 CAGCTTCCAAAACACAGTGGGGG - Intronic
1116095384 14:40360219-40360241 GTGCTTCCTAGATACAATGGGGG - Intergenic
1116533965 14:46007578-46007600 TTACTTCCTAAACAAAATGGAGG - Intergenic
1116931272 14:50693762-50693784 TTACTTCCTAAACACAATGGGGG + Intergenic
1117256854 14:53986499-53986521 TTACTTCCTAGACACAATGGGGG - Intergenic
1118780185 14:69002837-69002859 CAGCTTCCAAAACACAAAGATGG + Intergenic
1119560931 14:75589248-75589270 ATGCTTCCAAAATACAATGGCGG + Intronic
1120358110 14:83459588-83459610 CTACTTCCTAGATACAATGCGGG - Intergenic
1120415865 14:84217159-84217181 ATGCTTCCAAAACGCAATGATGG - Intergenic
1120947658 14:90013065-90013087 TTACTTCCTAAATACAATGTGGG - Intronic
1120956844 14:90090425-90090447 TTACTTCCTAAATACAATGGGGG - Intronic
1121875039 14:97443401-97443423 CTGCTTTCAAAATACAATGGTGG + Intergenic
1121890161 14:97582764-97582786 CTGCTTCCTAGACACAAAGTGGG + Intergenic
1122442326 14:101740634-101740656 CTGCTTCCAAGATACAATGGGGG + Intergenic
1122887988 14:104719040-104719062 CTGCTTCCTAAAGGCAACCCTGG + Exonic
1123098540 14:105777934-105777956 CTGCTTCCAAAGTACAATGATGG + Intergenic
1123107397 14:105848921-105848943 CTGCTTCCAAAGTACAATGATGG - Intergenic
1124124739 15:26929237-26929259 GTGCTTCCAAAATACAATGGGGG + Intronic
1124461711 15:29897869-29897891 TTACTTCCTAAATACAATGTGGG - Intronic
1125136142 15:36345473-36345495 ATGCTTCCAAAATACAATGTTGG - Intergenic
1125231438 15:37461820-37461842 TTACTTCCTAGACACAATGCAGG + Intergenic
1127585665 15:60375700-60375722 GTGCTGCCTAAACCAAATGCAGG - Intronic
1127676917 15:61248293-61248315 CACCTTTCGAAACACAATGCAGG - Intergenic
1127720520 15:61694547-61694569 TTGCTTCCAAAATACAATGGTGG - Intergenic
1128713454 15:69889265-69889287 GTGCTTCCAAAATACAATGGTGG - Intergenic
1129620281 15:77137637-77137659 TTACTTCCTAGATACAATGCAGG - Intronic
1130637003 15:85632251-85632273 TTGCTTCCTAAGCCCTATGCAGG + Intronic
1131994384 15:98120090-98120112 CTGCTTCCTCATCCCACTGCTGG + Intergenic
1132298446 15:100761709-100761731 CTGCTTCCTCCTCACAAGGCAGG - Intergenic
1132368832 15:101278450-101278472 TTGCTTTCTGAACACACTGCTGG - Intergenic
1134283532 16:12839354-12839376 CTGCTTCCAAAATGCAATGATGG - Intergenic
1135818045 16:25653928-25653950 CAGCTTCCTTAAGAAAATGCAGG - Intergenic
1135923300 16:26670424-26670446 CTGCTTCCAAAATACAATGGTGG + Intergenic
1138317273 16:56081153-56081175 GTGCTTCCGAAATACAATGGTGG + Intergenic
1138798944 16:60002404-60002426 TTACTTCCTAAATACAATTCAGG - Intergenic
1139030530 16:62875648-62875670 CTGCTTCCAAAATACAGTGGTGG + Intergenic
1141306005 16:82864893-82864915 CTGCTTCCTGGATACAATGGAGG + Intronic
1143213119 17:5203945-5203967 ATGCTTCCAAAATACAATGGTGG - Intergenic
1145038554 17:19559273-19559295 CTGATCCCTAACCACAATACAGG + Intronic
1145799795 17:27675736-27675758 CTTCTTCCAAAACTCAAAGCTGG - Intergenic
1146011660 17:29199424-29199446 CTCCCTCCTAAACAGAATCCTGG + Intergenic
1150668606 17:67169843-67169865 ATGCTTCCAAAATACAATGGTGG + Intronic
1151435306 17:74092068-74092090 CTACTTCCAAAATACAATGGTGG + Intergenic
1155632043 18:27905677-27905699 TTACTTCCTAAATACAATGGGGG + Intergenic
1155851782 18:30783164-30783186 TTACTTCCTAGACACAATGGAGG - Intergenic
1156127243 18:33921112-33921134 CTGCTTCTAAAAGACAATGGTGG - Intronic
1156467652 18:37357934-37357956 CTACTTCCTAAATACAGTGGGGG - Intronic
1156651199 18:39228645-39228667 TTACTTCCTAAATACAATGGGGG - Intergenic
1156995754 18:43465233-43465255 CTACTTCCAAGACACAATGGGGG + Intergenic
1157785747 18:50481143-50481165 CTGCTTCATAAACAAAATAATGG - Intergenic
1158222148 18:55160851-55160873 TTACTTCCTAGATACAATGCGGG - Intergenic
1159750965 18:72302458-72302480 TTACTTCCTAGACACAATGTGGG + Intergenic
1160339003 18:78070480-78070502 CTGCCTCCTAACCACAAGACCGG + Intergenic
1160413549 18:78690706-78690728 CTGCTTCTTAAGCACTGTGCGGG + Intergenic
1161887086 19:7005342-7005364 ATGCCTCATAAACACAATTCTGG - Intergenic
1162596594 19:11634145-11634167 TTGCTTCCTAGATACAATGGGGG - Intergenic
1164514472 19:28922085-28922107 CTGCTTCCAAGACACAATGCTGG - Intergenic
1167838858 19:52097379-52097401 CTGCTTCCAAAATACAATGGTGG - Intergenic
1167845609 19:52161900-52161922 GTGCTTCCAAAATACAATGGTGG + Intronic
1167846925 19:52172237-52172259 TTGCTTCCAAAATACAATGGTGG - Intergenic
1168347484 19:55657891-55657913 CTGCTTCGGAAAAACACTGCTGG - Intronic
1168496306 19:56854391-56854413 TTACTTCCTAGACACAATGGGGG - Intergenic
924965973 2:76890-76912 TTACTTCCTAGACACAATGGGGG + Intergenic
925016719 2:533327-533349 GTGCTTCCAAAATACAATGATGG + Intergenic
925257013 2:2499052-2499074 TTACTTCCTAGATACAATGCGGG + Intergenic
925301913 2:2823015-2823037 GTGCTTCCAAAATACAATGATGG + Intergenic
925455978 2:4017053-4017075 TTGCTTCCTAGATACAATGAAGG + Intergenic
926754224 2:16222733-16222755 CTGCTGGCTAAGCACAAAGCAGG + Intergenic
926816623 2:16804325-16804347 TTACTTCCTAAATACAATGGGGG + Intergenic
927476107 2:23415294-23415316 TAGCTTCCTAGACACAAGGCAGG + Intronic
928837067 2:35559645-35559667 TTACTTCCTAGACACAATGGGGG - Intergenic
928979921 2:37127183-37127205 CTACCTCCAAAACACATTGCTGG + Intronic
929350387 2:40944115-40944137 CTGCTTTGTAAACATAATGGTGG - Intergenic
929358211 2:41051323-41051345 TTACTTCCTAGATACAATGCGGG - Intergenic
929847645 2:45547019-45547041 CTGCCTCCTATACCAAATGCAGG - Intronic
930280337 2:49362160-49362182 TTACTTCCTAGACACAATGGAGG + Intergenic
930544195 2:52746259-52746281 CTACTTCCTAGATACAATGGGGG - Intergenic
931096200 2:58943458-58943480 CTACTTCCTAGATACAATGAAGG - Intergenic
931117712 2:59182511-59182533 CTGCTTCCTTTATTCAATGCTGG - Intergenic
931301394 2:60982116-60982138 CTTCCTCCTAGTCACAATGCAGG + Intronic
931496603 2:62813848-62813870 CTACTTCCAAAATACAATGGTGG - Intronic
931867617 2:66429302-66429324 CTGCTTCACAGATACAATGCTGG - Intergenic
932006664 2:67934044-67934066 CTACTTCCAAAATACAATGGTGG - Intergenic
932904316 2:75733361-75733383 TTGCTTCCTAGATACAATGGGGG + Intergenic
933297916 2:80511500-80511522 CTGCTTTCTTAACACATTGGTGG + Intronic
933508033 2:83203768-83203790 TTACTTCCTAGACACAATGGGGG + Intergenic
935091944 2:99903840-99903862 CTTCTTCCTAAATACATTACAGG + Intronic
936543819 2:113373441-113373463 TTGCTTCCTAGATACAATGGGGG + Intergenic
937935368 2:127239584-127239606 GTACTTCCTAGACACAATGGGGG - Intergenic
939053340 2:137332412-137332434 TTACTTCCTAGACGCAATGCAGG - Intronic
939740796 2:145902859-145902881 TTACTTCCTAAATACAATGCAGG - Intergenic
940322583 2:152392521-152392543 ATGCTCCCTAAACCAAATGCTGG - Intronic
940372518 2:152918702-152918724 GTGCTTCCAAAATACAATGATGG - Intergenic
940479902 2:154214893-154214915 CTGTTTCCCTAGCACAATGCTGG + Intronic
940485170 2:154288550-154288572 GTACTTCCTAAATACAATGGGGG + Intronic
940838633 2:158553756-158553778 CTGCTTCCAAAATACAGTGGTGG - Intronic
941162806 2:162054235-162054257 GTGCTTCCAAAATACAATGGTGG - Intronic
941346331 2:164373094-164373116 CTACTTCCTAGATACAATGGGGG - Intergenic
943093026 2:183396268-183396290 TTACTTCCTAAATACAATGGTGG - Intergenic
943313315 2:186353985-186354007 TTGCTTCCTAGATACAATGGGGG - Intergenic
944799382 2:203223129-203223151 GTGATTTCTAAACACATTGCAGG + Intronic
946469155 2:219940246-219940268 GTGCTTCCAAAATACAATGGTGG - Intergenic
946988892 2:225305280-225305302 CTGATTCCTAAACTTAATACTGG + Intergenic
947893349 2:233645513-233645535 TTACTTCCTAGACACAATGAGGG + Intronic
948311000 2:236986871-236986893 ATGCTTCTAAAACACAAGGCTGG - Intergenic
948824273 2:240566797-240566819 CTGCTCCCTGAGCCCAATGCGGG + Intronic
1169026947 20:2379647-2379669 CTCCTTCCTCAACACCCTGCAGG - Intergenic
1169968788 20:11246700-11246722 CTGTTTGCTAAACATAATGATGG - Intergenic
1170037608 20:12005260-12005282 TTACTTCCTAGACACAATGCGGG - Intergenic
1173128437 20:40362875-40362897 TTATTTCCTAAACAGAATGCTGG + Intergenic
1174055687 20:47796648-47796670 CAGCCTCCAAAACACAAAGCAGG - Intergenic
1177128646 21:17229064-17229086 CTGCTTCCAAAATACAAAGGTGG + Intergenic
1177839373 21:26218803-26218825 CTACTTCCTAGATACAATGGGGG - Intergenic
1179097768 21:38330926-38330948 ATGCTTCCAAAATACAATGGTGG + Intergenic
1179277819 21:39908055-39908077 CTGCTTCCCAAAGACAAAGTGGG + Intronic
1179316329 21:40247401-40247423 CTACTTCCTAGATACAATGGGGG + Intronic
1179402630 21:41098084-41098106 CTGCTCCCAAAATACAATGGGGG + Intergenic
1181929022 22:26384425-26384447 GTGCTTCCAAAACACAATGGTGG + Intergenic
1182698563 22:32212439-32212461 CTGGTTCCCAGACACAATGAAGG + Intergenic
1183004589 22:34890558-34890580 TTACTTCCTAGATACAATGCAGG - Intergenic
1184312025 22:43651917-43651939 TTGCTTCCTAGATACAATGAGGG - Intronic
1184507319 22:44912147-44912169 TTACTTCCTAAATACAATGAGGG - Intronic
949093853 3:62432-62454 CTGCCTCCAAAATACAATGATGG - Intergenic
949214706 3:1551854-1551876 GTGCTTCCAAAATACAATGGTGG - Intergenic
949464321 3:4328869-4328891 CTACTTCCTAGATACAATGGGGG + Intronic
949849352 3:8406848-8406870 CTGCTTCCAAGACACAATGGTGG - Intergenic
950700597 3:14743187-14743209 CTACTTCCTAGATACAATGGGGG + Intronic
950832412 3:15887796-15887818 GTGCTTCCAAAATACAATGGTGG - Intergenic
950931039 3:16789140-16789162 CTACTTCCAAAATACAATGGTGG + Intergenic
951058143 3:18172575-18172597 TTACTTCCTAGATACAATGCAGG + Intronic
952939534 3:38431969-38431991 TTACTTCCTAGACACAATGGAGG + Intergenic
953685876 3:45078087-45078109 TTACTTCCTAGACACAATGGGGG - Intergenic
953898405 3:46822793-46822815 TTGCTTCCTAAATAAAATGTGGG + Intergenic
954620384 3:51992116-51992138 GTGCTTCCTGAGCACAAGGCAGG + Intergenic
955649701 3:61180556-61180578 GTGCTTCCTAAACACAAAACTGG - Intronic
956401731 3:68887116-68887138 CTACTTCCAAAACACAGTGATGG + Intronic
956717859 3:72094102-72094124 CTGCCTGCTAATCACAAGGCAGG - Intergenic
957374393 3:79337064-79337086 TTACTTCCTAAATACAATGGAGG - Intronic
957590626 3:82192851-82192873 ATGCCACCTAAACACAATCCTGG + Intergenic
957625296 3:82647153-82647175 TTGCTTCCTAGATACAATGGGGG - Intergenic
957790710 3:84937358-84937380 CTGCTTCCAAAATGCAATGGTGG - Intergenic
958119384 3:89264220-89264242 CTGCTTCCTAAACACAATGCTGG + Intronic
959342394 3:105148372-105148394 TTACTTCCTAGATACAATGCAGG + Intergenic
959380964 3:105641146-105641168 CTACTTCCTAGACACAATGAGGG + Intergenic
959777686 3:110188252-110188274 TTGCTTCCAATATACAATGCAGG + Intergenic
960375226 3:116892729-116892751 CTGCTTCCAAAATACAACGTTGG + Intronic
960479440 3:118170990-118171012 GTGCTTCCAAAATACAATGACGG - Intergenic
961806463 3:129492742-129492764 CAGCTTCCTTAGCACACTGCAGG - Intronic
962431578 3:135325366-135325388 TTGCTTTCTCAGCACAATGCTGG - Intergenic
963391092 3:144665103-144665125 TTATTTCCTATACACAATGCAGG + Intergenic
963394478 3:144714863-144714885 TTTCTTCCTAAATACAATGGGGG + Intergenic
963524827 3:146404741-146404763 CTACTTCCAAAATACAATGGTGG + Intronic
963539397 3:146566574-146566596 CTACTTCCTAGATACAATGGGGG + Intergenic
964211815 3:154236932-154236954 CTGGGTCCAAAACAAAATGCAGG - Intronic
964212765 3:154246437-154246459 CTGCTTCCTACATACCAGGCTGG - Intronic
964314439 3:155428545-155428567 CTGATTCCTAAACAAAAAGGGGG - Intronic
964396918 3:156255464-156255486 CAGCTTACTAAACTCAATTCAGG - Intronic
964915734 3:161838922-161838944 ATGCTTCCAGAACACAATGTTGG - Intergenic
964933924 3:162059066-162059088 TTACTTCCAAAACACAATGTGGG + Intergenic
965025014 3:163291221-163291243 TTACTTCCTAAATACAATGGGGG + Intergenic
965028647 3:163335175-163335197 TTACTTCCTAGATACAATGCGGG + Intergenic
965187472 3:165483303-165483325 CTGCTTCCAAGGCACAATGGTGG - Intergenic
965237165 3:166138985-166139007 CTAATTCACAAACACAATGCTGG + Intergenic
966338954 3:178903389-178903411 GTGCTTCCAAAATACAATGGTGG - Intergenic
966576804 3:181511436-181511458 TTGCTTCCTAGATACAATGGGGG - Intergenic
967076846 3:186011118-186011140 CTGCTTCCAAAATACAATGATGG - Intergenic
970152696 4:13106725-13106747 CTACTTCCAAAATACAATGGTGG + Intergenic
970763351 4:19517581-19517603 TTGCTTCCTAGATACAATGGGGG - Intergenic
970999358 4:22304519-22304541 TTACTTCCTAGATACAATGCGGG - Intergenic
971816001 4:31489976-31489998 CTTCTTGCTATAGACAATGCAGG + Intergenic
972200050 4:36703282-36703304 TTGCTTCCTAGACACAATGAAGG - Intergenic
972301332 4:37788014-37788036 TTGCTTCCTAGATACAATGTGGG - Intergenic
972396498 4:38663654-38663676 CTGCTTCCAAAACACACAGCCGG - Intergenic
972797486 4:42436357-42436379 GTGGTTACAAAACACAATGCTGG + Intronic
973240492 4:47951123-47951145 CTGCTATCTACACACAATGTGGG - Intronic
973951164 4:56015681-56015703 CTGCTTCCAAAATAAAATGGTGG - Intronic
974153785 4:58044162-58044184 CTACTTCCTAGATACAATGTAGG - Intergenic
975506919 4:75148266-75148288 TTACTTCCTAGACACAATGGGGG + Intergenic
975981107 4:80160339-80160361 CTGAATCCAAAACACAATGGTGG + Intergenic
976323755 4:83747734-83747756 CTGCTTCCAAAACACAATAGTGG - Intergenic
976726825 4:88223091-88223113 CTGCTTCCTATATACAATGGGGG - Intronic
977046407 4:92073096-92073118 CTACTTCCAAAATACAATGGAGG - Intergenic
977067130 4:92332684-92332706 GTGCTTCCAAAATACAATGGTGG + Intronic
977746622 4:100557518-100557540 CTGGTTCCAAAGCACATTGCAGG + Intronic
978201681 4:106029516-106029538 TTACTTCCTAAATACAATGGGGG - Intergenic
978252554 4:106650171-106650193 CTTCTTCCTAGATACAATGTGGG - Intergenic
978383707 4:108158520-108158542 CTGCTTGCTACAGACAGTGCTGG + Intronic
979113461 4:116789202-116789224 ATGCTTCCAAAATACAATGGTGG - Intergenic
979748312 4:124244363-124244385 GTGCTTCCAAAATACAATGGTGG - Intergenic
980430083 4:132683428-132683450 TTGCTTCCTAGATACAATGAGGG + Intergenic
981070766 4:140535436-140535458 CTACTTCGTAAACACTATGGTGG + Intronic
981698542 4:147583248-147583270 TTTCTTCCTAAATACAATGGTGG + Intergenic
982299975 4:153868292-153868314 TTGCTTCCTAGATACAATGGAGG - Intergenic
982331629 4:154187380-154187402 GTGCTTCCAAAATACAATGATGG - Intergenic
982832856 4:160085878-160085900 TTACTTCCTAGACACAATGAGGG + Intergenic
982966420 4:161913848-161913870 TTACTTCCTAGATACAATGCGGG - Intronic
983874849 4:172863599-172863621 TTACTTCCTAAATACAATGGGGG - Intronic
985076874 4:186224622-186224644 TTACTTCCAAAACACAATGTGGG - Intronic
986258626 5:6123405-6123427 TTACTTCCTAGACACAATGGAGG + Intergenic
986264688 5:6181603-6181625 CTCCTGCCCAAAGACAATGCTGG - Intergenic
986454633 5:7903947-7903969 CAGCTTCCTAAGCACACAGCGGG - Intronic
986467280 5:8038158-8038180 TTACTTCCTAGACACAATGGGGG - Intergenic
986626731 5:9729524-9729546 CAGCTTGCCAAACACAATTCTGG - Intergenic
986751603 5:10792727-10792749 CAGCTTCCTAAACACACTGTGGG + Intergenic
986756671 5:10843432-10843454 TTACTTCCTAGACACAATGTGGG + Intergenic
986965583 5:13267192-13267214 TTACTTCCTAAATACAATGGGGG + Intergenic
986987442 5:13515171-13515193 TTACTTCCTAGATACAATGCAGG - Intergenic
987464299 5:18253454-18253476 CTACTTCCTAGATACAATGTGGG - Intergenic
987519643 5:18964387-18964409 CTGCTCCCAAAATACAATGGTGG + Intergenic
987562293 5:19540079-19540101 TTACTTCCTAGACACAATGGGGG + Intronic
987723002 5:21663049-21663071 TTACTTCCTAGATACAATGCGGG + Intergenic
987737885 5:21868679-21868701 CTGCTTCCAAAATACAATGGTGG - Intronic
987991471 5:25217971-25217993 TTACTTCCTAGACACAATGTGGG + Intergenic
987994761 5:25262660-25262682 CTGCTTCTTAAAAACAATTTGGG - Intergenic
988170811 5:27652918-27652940 TTACTTCCTAGACACAATGCAGG - Intergenic
988579704 5:32458399-32458421 CTACTTCCTAGAGACAATGGGGG + Intergenic
989367121 5:40669264-40669286 CTTCTTCCTAAACACATTGTAGG - Intergenic
990844483 5:60121901-60121923 TTACTTCCTAGAGACAATGCAGG + Intronic
991007750 5:61846487-61846509 CTACTTCCAAAATACAATGGTGG - Intergenic
991132270 5:63136316-63136338 CTGCTTCCAAAATACAATAATGG - Intergenic
991689663 5:69213888-69213910 GTGCTTCCAAAACACAATGATGG - Intergenic
992415618 5:76550146-76550168 TTGCTTCCAAAATACAATGATGG + Intronic
992854772 5:80848993-80849015 TTACTTCCTAAATACAATGGGGG + Intronic
993638157 5:90370738-90370760 TTACTTCCTAGATACAATGCGGG + Intergenic
993784897 5:92118071-92118093 CTGTTTCTAAATCACAATGCAGG + Intergenic
993893619 5:93505052-93505074 TTACTTCCTAAATACAATGGGGG + Intergenic
995033152 5:107502438-107502460 CTGCTTCCTAAAATGATTGCCGG - Intronic
995651670 5:114376701-114376723 CTTTTTCTTAAACACAATGGGGG + Intronic
995774534 5:115711429-115711451 CTACTTCCTAGATACAATGGGGG + Intergenic
996179383 5:120400153-120400175 TTACTTCCTAGACACAATGAAGG - Intergenic
996525337 5:124473309-124473331 CGTCTTCCTAAACACAAGCCTGG - Intergenic
996526775 5:124488690-124488712 TTGCTTCCTAGATACAATGGTGG + Intergenic
996582570 5:125047891-125047913 CTGCCCCCTACACACATTGCAGG - Intergenic
997049446 5:130362510-130362532 CTGCTTCCAAAATAAAATGGTGG + Intergenic
997250085 5:132381930-132381952 GTGGTTCCTAACCACAAGGCAGG - Intronic
997827102 5:137116278-137116300 TTGCTTCACAAACATAATGCTGG - Intronic
998278459 5:140781830-140781852 CTGCTTCCTGTACAGCATGCAGG + Intergenic
999089639 5:148924970-148924992 CTGCTTCCTGAACCCAACTCGGG - Intronic
999418263 5:151418624-151418646 TTACTTCCTAGACACAATGGTGG - Intergenic
1000030405 5:157396706-157396728 TTACTTCCTAAATACAATGGGGG + Intronic
1000515915 5:162236356-162236378 TTACTTCCTAGACACAATGCGGG + Intergenic
1000612416 5:163388577-163388599 TTACTTCCTAGACACAATGGGGG + Intergenic
1001351696 5:170974248-170974270 ATGCTTCCAAAATACAATGGTGG + Intronic
1002464660 5:179400907-179400929 TTTCTTCCTAGACACAATGCAGG - Intergenic
1003277022 6:4661709-4661731 CTGCTTTCTAGACACCAGGCCGG - Intergenic
1004469627 6:15917549-15917571 CTGGTTCCTCAGCACAATACAGG - Intergenic
1004472150 6:15938991-15939013 TTACTTCCTAGACACAATGGGGG - Intergenic
1004703998 6:18106212-18106234 CTGCTTATTAGACACAATGGAGG + Intergenic
1004805634 6:19201260-19201282 TTACTTCCTAAATACAATGGAGG + Intergenic
1004830744 6:19474795-19474817 TTACTTCCTAAACACAGTGAGGG + Intergenic
1005229511 6:23684279-23684301 CTGTTTCCAAAATACAATGGTGG + Intergenic
1005716161 6:28550296-28550318 CTGCTTCCAAAATACAGTGGTGG - Intergenic
1007186009 6:39972785-39972807 TTACTTCCTAGACACAATGGGGG - Intergenic
1007427897 6:41759170-41759192 CTGCTTCCTAAGCTCATGGCTGG - Intergenic
1008363687 6:50650665-50650687 CTACTTCCTAAATACAATGGGGG - Intergenic
1009710307 6:67309157-67309179 TTGCTTCCAAGACACAATGGAGG - Intergenic
1009726645 6:67543530-67543552 TTGCTTCCTAGATACAATGAGGG - Intergenic
1009825143 6:68857589-68857611 TTACTTCCTAGATACAATGCAGG - Intronic
1010248261 6:73682246-73682268 TTGCTTCCTAGATACAATGGAGG + Intergenic
1010539062 6:77069170-77069192 TTGCTTCCTAGATACAATGGGGG + Intergenic
1010690014 6:78899265-78899287 CACCTTCCTAAACATATTGCTGG - Exonic
1010900629 6:81423312-81423334 CTACTTCCTAGATACAATGGAGG - Intergenic
1011236860 6:85227941-85227963 CTACTTCCTAGATACAATGGGGG + Intergenic
1011919079 6:92548191-92548213 TTACTTCCTAGACACAATGGGGG - Intergenic
1011947251 6:92921794-92921816 CTAATTCCAAAGCACAATGCTGG + Intergenic
1012896654 6:104956837-104956859 CTTCTACTTAAACACAATGGAGG - Intergenic
1012964493 6:105658329-105658351 CTCCTTCCAAAATACAATGGTGG - Intergenic
1013717284 6:112976646-112976668 TTGCTTCCTAGATACAATGTGGG - Intergenic
1013730200 6:113155837-113155859 CTACTTCCAAAATACAATGGTGG - Intergenic
1014882981 6:126746050-126746072 GTACTTCCTAGATACAATGCGGG + Intergenic
1015673866 6:135723184-135723206 TTACTTCCTAGACACAATGGGGG - Intergenic
1015936106 6:138407290-138407312 ATGCTTCCAAAATACAATGGTGG + Intronic
1016367636 6:143336851-143336873 CTGCTTCCAAAACAGAATGGTGG + Intronic
1016621129 6:146109973-146109995 CTACTTCCTAGATACAATGAGGG - Intronic
1017411209 6:154169476-154169498 CTGCTTCTAAAACACAGTGTGGG + Intronic
1017426039 6:154322535-154322557 CTGCCTCCTAAAGAAAATGTTGG + Intronic
1018041095 6:159922694-159922716 TTACTTCCTAGACACAATGGGGG - Intergenic
1018171923 6:161150577-161150599 CTGCTGCCTGACCACCATGCGGG + Intronic
1018466216 6:164047903-164047925 CTACTTCCTAAATACAATGGGGG - Intergenic
1018585271 6:165350421-165350443 TTACTTCCTAGACACAATGGGGG - Intronic
1019011219 6:168844916-168844938 CTGGTGCCTACACACATTGCTGG + Intergenic
1019026648 6:168971263-168971285 GTGCTTACAAAACACAATGGTGG + Intergenic
1020407594 7:7854871-7854893 TTGCTTCCTAGATACAATGGGGG + Intronic
1020754030 7:12178687-12178709 CTGCTTTCAAAAAAAAATGCTGG + Intergenic
1020942893 7:14562721-14562743 TTGCTTCCTAGATACAATGGGGG - Intronic
1021424265 7:20481710-20481732 ATGCTTCCAAAATACAATGGTGG - Intergenic
1021662360 7:22932507-22932529 CTGCTTCCAAAATACAATGGTGG - Intergenic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1024089960 7:45928585-45928607 CTGCTTCCAAAACACAATAGTGG - Intergenic
1024196261 7:47061847-47061869 GTGCTTCCAAAATACAATGGTGG - Intergenic
1024414072 7:49081899-49081921 CTGCTTCCAAAATACAATGCTGG + Intergenic
1024431617 7:49294890-49294912 CTGCTTCCAAAATACAATGGTGG + Intergenic
1025237296 7:57243511-57243533 CAGCCTCCAAAACACAAAGCAGG + Intergenic
1025604070 7:63026147-63026169 CTCCTTCCTAATCACAACGTTGG + Intergenic
1026120423 7:67532069-67532091 CTGCTTCCAAAATACAATGGTGG + Intergenic
1027767262 7:82360708-82360730 CTGCATCATAAAAACAATGAAGG - Intronic
1027993468 7:85394752-85394774 TTACTTCCTACACACAATGGGGG + Intergenic
1029215434 7:98945146-98945168 AAGCTTCCTAAACACAGTGATGG - Intronic
1031140075 7:117932701-117932723 CTGCTTCCAAAATACATTGGTGG + Intergenic
1033845124 7:145422406-145422428 CTGCATCCTATACACCATGCTGG - Intergenic
1033905105 7:146192880-146192902 TTGCTTCCTAGATACAATGGAGG + Intronic
1034851998 7:154502144-154502166 TTACTTCCTAAATACAATGGGGG - Intronic
1035149817 7:156860681-156860703 TTTCTTCCTAGACACAATGAGGG + Intronic
1035452028 7:158983471-158983493 CTGCTTTCTAGATACAATGGGGG + Intergenic
1036128129 8:6082478-6082500 CTGCTTTCCTAACACAAAGCAGG + Intergenic
1036781112 8:11648510-11648532 CTCCTTCCTAATCACAACGTTGG - Intergenic
1039497598 8:37992731-37992753 TTACTTCCTAAATACAATGGGGG + Intergenic
1039651089 8:39340138-39340160 GTGCTTCCAAAATACAATGGAGG + Intergenic
1041339168 8:56823429-56823451 TTACTTCCTAAATACAATGGGGG - Intergenic
1042412611 8:68481790-68481812 TTACTTCCTAGACACAATGGGGG - Intronic
1042761073 8:72272000-72272022 CTGCTTCCAAAGCACAATTATGG + Intergenic
1042845154 8:73162592-73162614 CCCCTTCCTAAACACAATGATGG + Intergenic
1042960077 8:74294025-74294047 CGACTTCCAAAACACAATGCAGG + Intronic
1044234043 8:89809616-89809638 TTACTTCCTAGACACAATGGAGG - Intergenic
1044496898 8:92897117-92897139 CTACTTCCAAAGTACAATGCTGG - Intronic
1044606898 8:94055872-94055894 TTGCTTCATAGACACATTGCTGG + Intergenic
1046917488 8:119692632-119692654 TTACTTCCTACACACAATGTGGG - Intergenic
1047205842 8:122802584-122802606 CTGCTTGCTCAACACCATGCGGG - Intronic
1047586991 8:126283405-126283427 TTGCTTCCTAGATACAATGGGGG - Intergenic
1048892706 8:138962084-138962106 GTGCTTCCAAAATACAATGGTGG - Intergenic
1048901418 8:139041542-139041564 CTGTTTCCTGGATACAATGCTGG - Intergenic
1049458563 8:142709126-142709148 ATGCTTCCAAAATACAATGGTGG + Intergenic
1049499024 8:142951490-142951512 CTGCTGCCTCATCTCAATGCAGG + Intergenic
1049557410 8:143289827-143289849 CTGCCTCCTAGACACAGTCCCGG - Intronic
1050582628 9:7076578-7076600 CCCCATCCTAAACACGATGCTGG - Exonic
1050849394 9:10264578-10264600 CTACTTCCTAGATACAATGGGGG - Intronic
1050935815 9:11393280-11393302 TTACTTCCTAAATACAATGGAGG - Intergenic
1051572946 9:18581659-18581681 CTGCTTCCAAAATACAATGGTGG + Intronic
1051950216 9:22621858-22621880 CTACTTCCAAAATACAATGGTGG - Intergenic
1051963992 9:22803607-22803629 GTGCTTCCAAAATACAATGGTGG + Intergenic
1051979434 9:22996745-22996767 TTACTTCCTAGACACAATGGCGG + Intergenic
1052199135 9:25756783-25756805 GTGCTTCCAAAATACAATGATGG - Intergenic
1052488577 9:29133362-29133384 CTGATTTCTAAACATAATGTGGG + Intergenic
1052526941 9:29630186-29630208 TTACTTCCTAGACACAATGAGGG - Intergenic
1052689800 9:31802513-31802535 TTACTTCCTAAACACAAGGGAGG - Intergenic
1053861930 9:42395904-42395926 TAGCTTCCAAAACACAATGGTGG + Intergenic
1054878563 9:70121859-70121881 CTCCTTTCTAAAAACAATGATGG - Intronic
1054902777 9:70387603-70387625 GTGCTTTTTAAAAACAATGCAGG + Exonic
1055175488 9:73313429-73313451 TTGCTTCCTAGATACAATGAGGG + Intergenic
1055595514 9:77861525-77861547 TTACTTCCTAGATACAATGCGGG + Intronic
1055848420 9:80594990-80595012 TTGCTTCCTAGACAAAATGGTGG - Intergenic
1056281577 9:85046088-85046110 CTACTTCCAAAATACAATGATGG - Intergenic
1056595245 9:88002515-88002537 TTACTTCCTAAATACAATGGGGG - Intergenic
1057073295 9:92119103-92119125 CTGCTTCGAAAACACAAAGGTGG + Intergenic
1057137823 9:92706467-92706489 GTGCTTCCAAAATACAATGGTGG + Intergenic
1059404336 9:114090704-114090726 ATGCTTCCTATACAGACTGCAGG + Intronic
1059619831 9:115991670-115991692 CTGCTCCTTAAAAACAATGTAGG + Intergenic
1059986380 9:119824195-119824217 TTACTTCCTAGACACAATGGGGG - Intergenic
1061459947 9:130729503-130729525 CACCTTCCCAAACACAGTGCAGG - Intronic
1186500106 X:10044254-10044276 GTGCTTCCAAAATACAATGGTGG + Intronic
1188061346 X:25605813-25605835 TTGCCTGCTAAACACAATGCAGG - Intergenic
1188062404 X:25617694-25617716 CTGCTTCCTAGATAGAATGAGGG + Intergenic
1188187219 X:27130300-27130322 CTACTTCCTAGATACAATGGGGG + Intergenic
1189254037 X:39623644-39623666 GTGCTTCCAAAATACAATGGTGG + Intergenic
1190146352 X:47894840-47894862 CTGCTTCCAAAATACAATGGTGG - Intronic
1190240465 X:48654283-48654305 TTGCTTCCAAAATACAATGATGG + Intergenic
1190685712 X:52870809-52870831 CTGCTTCCAAAACAGCATGAAGG - Intergenic
1191598378 X:62973799-62973821 TTACTTTCTAAACACAATGGGGG + Intergenic
1191680095 X:63831730-63831752 TTGCTTCCTAGATACAATGGGGG - Intergenic
1193027629 X:76861602-76861624 ATGCTTCCAAAATACAATGGAGG - Intergenic
1193250123 X:79281257-79281279 TTACTTCCTAGACACAATGGAGG + Intergenic
1193455829 X:81730192-81730214 TTACTTCCTAAATACAATGGGGG - Intergenic
1193548620 X:82860920-82860942 ATGCTTCCAAAATACAATGGTGG - Intergenic
1194106341 X:89771718-89771740 CTGCGTCCAAAATACAATGATGG - Intergenic
1194220542 X:91183858-91183880 TTACTTCCTAAATACAATGGGGG - Intergenic
1194300676 X:92182305-92182327 TTACTTCCTAAATACAATGGGGG - Intronic
1194360259 X:92941537-92941559 CTACTTCCTAGATACAATGGGGG + Intergenic
1194474066 X:94336157-94336179 TTACTTCCTAAATACAATGGGGG - Intergenic
1194861068 X:98999428-98999450 TTACTTCCTAAATACAATGGGGG - Intergenic
1194890847 X:99376569-99376591 CTGCTTCCAAAATATAATGATGG + Intergenic
1194978292 X:100414651-100414673 CTCAATCCTTAACACAATGCTGG - Intergenic
1195871430 X:109490725-109490747 CTGAATGCTACACACAATGCGGG - Intergenic
1196314599 X:114208630-114208652 GTGCTTCCAAAACACAATGGTGG + Intergenic
1196379951 X:115078403-115078425 CTACTTCCTAGACAGAATGCAGG - Intergenic
1196526015 X:116727731-116727753 TTGCTTCCTAGATACAATGGAGG - Intergenic
1196579477 X:117362044-117362066 TTACTTCCTAGATACAATGCGGG - Intergenic
1197033557 X:121848044-121848066 CTGCTTCCAAAATACAATAGTGG - Intergenic
1197058458 X:122148467-122148489 CTACTTCCAAAATACAATGATGG - Intergenic
1197342464 X:125289311-125289333 CTGCTTCTAATACACAATGGTGG - Intergenic
1197578708 X:128255566-128255588 TTACTTCCTAAATACAATGGGGG + Intergenic
1197819066 X:130528290-130528312 CTGCTTTCAAAATACAATGGTGG + Intergenic
1199027800 X:142960676-142960698 CTACTTCCTACATACAATGGGGG + Intergenic
1199049678 X:143222344-143222366 GTGCTTCCAAAACACAATGGTGG + Intergenic
1199178564 X:144823463-144823485 CTGCTTCCTCAAAACCCTGCTGG + Intergenic
1199219138 X:145297021-145297043 CTGCTTCCAAAGGACAATGGTGG + Intergenic
1199869873 X:151888651-151888673 TTACTTCCTAAGCACAATGGAGG - Intergenic
1200557052 Y:4647610-4647632 TTACTTCCTAAATACAATGGGGG - Intergenic
1200668463 Y:6057355-6057377 CTACTTCCTAGATACAATGGGGG + Intergenic