ID: 958124282

View in Genome Browser
Species Human (GRCh38)
Location 3:89335287-89335309
Sequence CTCAGATGATAGAAGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 779
Summary {0: 1, 1: 0, 2: 21, 3: 132, 4: 625}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958124275_958124282 10 Left 958124275 3:89335254-89335276 CCGGGTTCATAGGTGACACCTGC 0: 1
1: 0
2: 8
3: 74
4: 295
Right 958124282 3:89335287-89335309 CTCAGATGATAGAAGGGACAAGG 0: 1
1: 0
2: 21
3: 132
4: 625
958124278_958124282 -8 Left 958124278 3:89335272-89335294 CCTGCTAGCTGGGTCCTCAGATG 0: 1
1: 0
2: 6
3: 154
4: 1578
Right 958124282 3:89335287-89335309 CTCAGATGATAGAAGGGACAAGG 0: 1
1: 0
2: 21
3: 132
4: 625

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958124282 Original CRISPR CTCAGATGATAGAAGGGACA AGG Intronic
902111050 1:14078646-14078668 CTCACAGGATGGAAGGGGCAAGG + Intergenic
902320792 1:15664059-15664081 ATAAAATGATGGAAGGGACAAGG - Exonic
904328047 1:29740148-29740170 CTGAGAAGAAAGAAGGGACGAGG + Intergenic
905110762 1:35592809-35592831 CTCACATTGTAGAAGGGAGAAGG + Intronic
905286754 1:36885647-36885669 CTCAGAGGGTGGAAGGAACATGG - Intronic
905827081 1:41034013-41034035 ATCAAATGAAAGAAGGGATATGG - Exonic
905861455 1:41354760-41354782 CTCACATGACAGAAGGGGCAGGG + Intergenic
906068707 1:43001804-43001826 CTTACATGGTAGAAGGGGCAAGG + Intergenic
906194855 1:43923580-43923602 CTCATATGATGGAAGAGGCAAGG + Intronic
906259336 1:44374669-44374691 CTCAGATGGTAGAAGAGGCAAGG - Intergenic
907547113 1:55271734-55271756 CTCCCATGATGGAAGAGACAAGG - Intergenic
907706257 1:56835069-56835091 CACAGATGGTAGAAGGAGCAAGG - Intergenic
907791774 1:57673180-57673202 CTCACATGACAGAAGGGGCATGG + Intronic
907877259 1:58503653-58503675 CTCACATGGTAGAAGGGGCAAGG - Intronic
907928346 1:58975577-58975599 CTCACATGATGGAAGGGATAAGG + Intergenic
908176354 1:61559029-61559051 CTCACGTGGTGGAAGGGACAAGG + Intergenic
909020442 1:70425449-70425471 CTCACATGGTAGAAGAGACAAGG + Intronic
909052416 1:70782630-70782652 CTCACATGGTGGAAGGGACAAGG - Intergenic
909198324 1:72655769-72655791 CTCACATGGTGGAAGGGGCAAGG - Intergenic
909454680 1:75837167-75837189 TTCACATGGTAGAAGGGGCAAGG - Intronic
909464961 1:75963315-75963337 CTCAGATGAGGTAAGGGTCATGG - Intergenic
909589902 1:77335940-77335962 CTCACATGGTGAAAGGGACAGGG + Intronic
909933724 1:81527740-81527762 CTCAAATGGTGGAAAGGACAAGG - Intronic
910341443 1:86192962-86192984 CTTAGAGGGTAGAAGGCACAGGG + Intergenic
910483042 1:87679321-87679343 CTCATGTGGTAGAAGGGGCAAGG - Intergenic
910544645 1:88400117-88400139 CTCACATGGTAGAAGGGGCAAGG + Intergenic
911111651 1:94194593-94194615 CTCACATGATAGAAGGGGAAGGG + Intronic
911156135 1:94638604-94638626 CTCACATGATGGAAGGGGTAAGG - Intergenic
911408233 1:97468439-97468461 CTCACATGATGGAAAGGACAAGG - Intronic
912269712 1:108196728-108196750 CTCACATGGTGGAAGGGGCAAGG + Intronic
912908722 1:113734826-113734848 CTCACATGGTGGAAGGGGCAAGG - Intronic
913050288 1:115111657-115111679 CTCACATGGTAGAAGGGGAAGGG - Intergenic
913346322 1:117814443-117814465 CTCACATGGTGGAAGGGGCAAGG - Intergenic
914172403 1:145237613-145237635 CTCACATGGTGGAAGGGGCAAGG + Intergenic
915841915 1:159220201-159220223 CTCATGTGGCAGAAGGGACAAGG + Intergenic
915863384 1:159471771-159471793 CTCAGTTGGCAGAAGGGGCAAGG - Intergenic
916078559 1:161217910-161217932 CTCAGAGGAGAGAAGGGAAGGGG - Intronic
916264487 1:162876968-162876990 CTCACATGACAGAAGGGAGGAGG - Intergenic
916309824 1:163385698-163385720 CTCAGGTGGTAGAAGGGAGTGGG + Intergenic
916349445 1:163832418-163832440 CTCAGATGCTAGAAGTGAGAGGG + Intergenic
916539220 1:165736090-165736112 CTCACATGGTGGAAGGCACAGGG - Intronic
916804686 1:168247816-168247838 CACAGATGCTGGAAAGGACAGGG - Exonic
916993365 1:170268528-170268550 TTCACATGATGGAAGGTACAAGG - Intergenic
917005032 1:170405620-170405642 CTCACATGACAGAAGGGGTAAGG - Intergenic
918025494 1:180740893-180740915 CTCACATGGTAAAAGGGGCATGG + Intronic
918356946 1:183713621-183713643 CTCACATGGTAGAAGGGATGAGG - Intronic
919365979 1:196661534-196661556 CTCCAATGATGAAAGGGACAAGG + Intronic
921029179 1:211322360-211322382 TTCAGAGGATAGAAGTGGCAAGG + Intergenic
921326907 1:213994507-213994529 GTCAGATGACAGAAAGAACAAGG - Intronic
921686464 1:218094749-218094771 CTCACATGGTAGAAGGGGCAAGG - Intergenic
921718983 1:218449785-218449807 CTCACATGGTAGCAGGGCCAAGG + Intergenic
921821601 1:219623131-219623153 CTCACATGGTGGAAGGGACAAGG - Intergenic
922327808 1:224545312-224545334 TTAAGATGAGAGAAGAGACAAGG - Intronic
922514184 1:226194695-226194717 CTCACATGGTAGAAGGGACAAGG + Intergenic
923315908 1:232779872-232779894 CTCACATGGTAGAAAGGGCAAGG + Intergenic
923497821 1:234540462-234540484 CACAGATGCAAGAAGGGGCAAGG - Intergenic
923899721 1:238312401-238312423 CTCACATGGTGGAAGGGGCAAGG + Intergenic
924072655 1:240297919-240297941 CTCACATGGTAGAAGGGACAAGG + Intronic
924187591 1:241511220-241511242 CTCACATGGTAGAAGGGACAAGG - Intronic
924272681 1:242350079-242350101 CCCACATGATAGAAGGGGCAAGG - Intronic
924494870 1:244577602-244577624 CTCACATGGCAGAAGGGGCAAGG + Intronic
924798938 1:247313084-247313106 CTCACATGGTGGAAGGGGCAAGG + Intronic
924809651 1:247389865-247389887 CTCACATGGTGGAATGGACAAGG + Intergenic
1063010189 10:2014066-2014088 CTCATATGGTGGAAGGGCCAAGG - Intergenic
1064694926 10:17955528-17955550 CTCAGATGACAGAACAGACTCGG - Intronic
1065327462 10:24561474-24561496 CTCACATGGTAGAGGGGGCAAGG - Intergenic
1066054576 10:31668500-31668522 CTCACATGGAAGAAGGGACAGGG + Intergenic
1066128896 10:32371031-32371053 TTCTGAGGATAGAAAGGACATGG + Intronic
1066136296 10:32449853-32449875 CTCACATGATGGAAGGAGCAAGG - Intronic
1066680105 10:37929944-37929966 CTCACATGATAGAAGGGGCAAGG + Intergenic
1066712030 10:38246548-38246570 CCCACATGATAGAAGGGGCAAGG + Intergenic
1067050203 10:43011582-43011604 CTCACATGGTGGAAGGGACAGGG - Intergenic
1068293367 10:55033958-55033980 CTCACATGATAGAAGGTGAAGGG - Intronic
1068524778 10:58116087-58116109 CTCACATGGTAAAAGGGGCAAGG + Intergenic
1068766645 10:60771806-60771828 CTCACATGGTAGAGGGGGCAAGG - Intergenic
1068804082 10:61174972-61174994 CTCAGATGACAGAAGGCAGAAGG + Intergenic
1068902673 10:62287494-62287516 CTCACATGGCAGAAGGGGCAAGG + Intergenic
1070311891 10:75279853-75279875 CTCACATGGCAGAAGGCACAAGG + Intergenic
1070487108 10:76941907-76941929 CTCACATGACAGAAGGGACGAGG + Intronic
1070532472 10:77349243-77349265 CTCACATGGTGGAAGGGGCAAGG - Intronic
1070557734 10:77542095-77542117 CTCACATGATGGAAGGGACCAGG - Intronic
1070747511 10:78943458-78943480 ATCAGAAGCTGGAAGGGACAAGG - Intergenic
1070837712 10:79460793-79460815 CCAAGAAGCTAGAAGGGACAAGG - Intergenic
1071177238 10:82940723-82940745 CTCACATGGTAGAAGGGGCAGGG + Intronic
1072642370 10:97221605-97221627 CTCACATGGTGGAAGGGACAAGG - Intronic
1073040476 10:100600994-100601016 CTCACATGGCAGAAGGGACAGGG + Intergenic
1073470649 10:103720186-103720208 CTCACATGATGGAAGGGGCAAGG + Intronic
1073487155 10:103826835-103826857 ATCAGATGAGATAACGGACATGG + Intronic
1073748474 10:106496982-106497004 CTCAGAGGTTAGAAGCGAAATGG - Intergenic
1074079707 10:110157797-110157819 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1074244982 10:111680710-111680732 CTCACATGGCAGAAGGGACGGGG - Intergenic
1074836470 10:117300782-117300804 CTCACATGGCAGAAGGGATAAGG - Intronic
1074939172 10:118218042-118218064 CTCGAACGATGGAAGGGACAAGG + Intergenic
1075268454 10:121026512-121026534 CACAGATGTGAGAAGGGAAAGGG - Intergenic
1076841239 10:133046708-133046730 CTCAGCTGGGAGATGGGACAGGG - Intergenic
1077159649 11:1106924-1106946 CTCAGAAGTGAGGAGGGACATGG + Intergenic
1078255161 11:9652555-9652577 CTGAGATGAGAGAAGGGAATTGG - Intergenic
1078711051 11:13791493-13791515 CTCACATGCTGGAAGGAACAAGG - Intergenic
1079073172 11:17365979-17366001 CTCAGAGAATTGAAGTGACAGGG - Intronic
1079167871 11:18063836-18063858 CTCAGATGTTAGAAGCCATATGG + Intergenic
1079332043 11:19541632-19541654 CCCACTTGAGAGAAGGGACAGGG + Intronic
1079738497 11:24028228-24028250 TTCACATGGTAGAAGGGACAAGG + Intergenic
1079969163 11:27015459-27015481 CTCATGTGGCAGAAGGGACAGGG + Intergenic
1080095763 11:28404472-28404494 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1080116446 11:28626490-28626512 CTCACATGGTGTAAGGGACAAGG + Intergenic
1080195483 11:29603624-29603646 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1080294093 11:30705281-30705303 CTCACATGGTGGAAGGGACAAGG + Intergenic
1080392119 11:31857991-31858013 CTCACATGGTAGAAGAGGCATGG - Intronic
1080397288 11:31901949-31901971 CTCACATGGCAGAAGGGGCAAGG + Intronic
1080695031 11:34596054-34596076 CTCACATGGCAGAAGGGACAAGG - Intergenic
1080739029 11:35046815-35046837 CTCACAGGATGGAAGGGGCAAGG + Intergenic
1080762843 11:35269140-35269162 CTCACATGGTAGAAGGGCCAAGG - Intronic
1080827055 11:35857254-35857276 CTCACCTGGTAGAAGGGACCTGG + Intergenic
1080942376 11:36933973-36933995 CTCACATGGTTGAAGGGGCAAGG + Intergenic
1081363358 11:42206033-42206055 CTCCCCTGATAGAAGGCACAGGG - Intergenic
1081660979 11:44888224-44888246 CTCAGATGCCAGAAGGCACATGG - Intronic
1081853496 11:46290032-46290054 ATCAGAGGAGAGAAGGGACCTGG - Intronic
1082782545 11:57299045-57299067 CATACATGGTAGAAGGGACAAGG - Intergenic
1082874775 11:57977318-57977340 CTCACATGGTGGAAGGGACAAGG - Intergenic
1082990227 11:59201150-59201172 CCCACATGGTAGAAGGGGCAAGG + Intronic
1083904342 11:65660365-65660387 GTCAGCTGAGTGAAGGGACAGGG - Intronic
1084012672 11:66361363-66361385 CTCTGATGATATTAGGGAAACGG - Intronic
1084081102 11:66825521-66825543 CTCACATGGCAGAAGGGGCAAGG - Intronic
1084100266 11:66943317-66943339 CTCACAGGGTGGAAGGGACAAGG - Intronic
1084627702 11:70321172-70321194 CTCACATGATGGAAGGGACCAGG - Intronic
1086125886 11:83348054-83348076 GTCAGATGGCAGAAGGGTCAAGG - Intergenic
1086949177 11:92873871-92873893 CTCAGATTTTAGAAAGGAAATGG - Intronic
1087105456 11:94402744-94402766 GACAGATCCTAGAAGGGACAAGG + Intergenic
1087109070 11:94443565-94443587 CTCATCTGATAGAATGGACCTGG - Intronic
1087673662 11:101134248-101134270 CTCACATGGTAGAAGGGGCAGGG - Intergenic
1087687717 11:101284245-101284267 CTCACATGGCAGAAAGGACAAGG - Intergenic
1088224331 11:107603164-107603186 CTCTGCTGATAGAATGGAGAGGG + Intronic
1088399340 11:109406153-109406175 CTCAGAGGCTGGCAGGGACATGG - Intergenic
1088416450 11:109594600-109594622 CTCACATGACAGAAGGCAGAAGG + Intergenic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1089420536 11:118330094-118330116 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1089639541 11:119838715-119838737 CTCACATGCTGGAAGGGCCAAGG + Intergenic
1090212195 11:124929079-124929101 CACAGAAGATAGAAGGGAGAGGG - Intronic
1091017243 11:132063142-132063164 CTCATGTGGTAGAAGGGGCAAGG + Intronic
1091195740 11:133729355-133729377 CTCACATGGCAGAAGGGACAAGG + Intergenic
1091521590 12:1249859-1249881 CTCACATGGTGGAAGGGGCAAGG + Intronic
1091951894 12:4599796-4599818 CTCAGATGATGGGACTGACATGG - Intronic
1092565881 12:9664991-9665013 CTCACATAGTAGAAGGAACAAGG - Intronic
1093610858 12:21154344-21154366 CTCACATGTTAGAAGAGGCAAGG - Intronic
1093769596 12:23003297-23003319 CTCACCTGGTAGAAGGGAAAAGG + Intergenic
1094442869 12:30498652-30498674 CTCACATGGTGGAAGGGATAAGG - Intergenic
1095933794 12:47655229-47655251 CTCCCATGGGAGAAGGGACAAGG + Intergenic
1097738924 12:63215506-63215528 CTCACATGATAGAGGAGGCAAGG - Intergenic
1098081232 12:66787626-66787648 CTTACATGACAGAAGGAACAAGG - Intronic
1098191721 12:67956232-67956254 CTCACATGGTTGAAGAGACAGGG - Intergenic
1098798100 12:74919361-74919383 CTCACATCATACAAGTGACAAGG - Intergenic
1098826451 12:75303712-75303734 ATTATATGGTAGAAGGGACATGG + Intronic
1099148690 12:79080857-79080879 TTAAGATGACAGATGGGACAAGG + Intronic
1099242368 12:80153273-80153295 CTCAGATGGTGGAAGGAGCAAGG + Intergenic
1099257497 12:80331908-80331930 ATCAGAGGAAAGAAGGGAAAAGG + Intronic
1099303001 12:80921148-80921170 CTCACGTGGTAGAAGGGGCAAGG - Intronic
1099438489 12:82671104-82671126 CCCACATGATGGAAGGGGCAAGG - Intergenic
1099482310 12:83183253-83183275 CTCACATGGTAGAAAGGGCAAGG + Intergenic
1099790938 12:87332644-87332666 TTCACATGGTGGAAGGGACAGGG - Intergenic
1100188805 12:92168023-92168045 CTCACATAATGGAAGGGGCAAGG + Intergenic
1100266669 12:92983577-92983599 ATCAGATGGTTGAAGGGATATGG - Intergenic
1100288081 12:93186816-93186838 CTCACATGGTGGAAGGGACAAGG - Intergenic
1100468554 12:94871164-94871186 CTCACATCATGGAAGGGACAAGG + Intergenic
1101042752 12:100773177-100773199 CTCACATGGTAGATGGGACAAGG + Intronic
1101317257 12:103640756-103640778 CTCACATGATAGAAAGAAGATGG + Intronic
1101469265 12:104981375-104981397 CTCACATGGTAGAAGGGACAAGG - Intergenic
1102515222 12:113441768-113441790 CTCAGCTGCTAGAAGCCACAGGG - Intergenic
1103076404 12:117986309-117986331 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1103301146 12:119927419-119927441 CTCAGACGGTGGAAGGGGCAAGG - Intergenic
1106782725 13:33075894-33075916 CTCACATGGTAGAAGGTAGAGGG + Intergenic
1106964850 13:35050934-35050956 CTCAAATAATAGCAGAGACAAGG + Intronic
1107041668 13:35955399-35955421 CTCACGAGGTAGAAGGGACAAGG + Intronic
1107263918 13:38528116-38528138 TGCAGAAGATAGAATGGACAGGG - Intergenic
1107371360 13:39753248-39753270 GTCACATGGTAGAAGGGACAGGG - Intronic
1108091832 13:46857428-46857450 CTCACAGGATGGAAGGGCCAAGG + Intronic
1108118525 13:47158074-47158096 TTCACATGATGGAAGGGAAAAGG - Intergenic
1108238925 13:48441218-48441240 CTCAGATGGTGGAAGGGACAAGG + Intronic
1109433493 13:62267825-62267847 CTCTCATGGTAGAAGGGTCAAGG - Intergenic
1109741033 13:66555378-66555400 TTCAGATGATAAAAGGAACAAGG - Intronic
1110398691 13:75064609-75064631 CTCACATGATGGAAGGCAGAAGG + Intergenic
1110662320 13:78071748-78071770 CTGACATGACAGAAAGGACATGG - Intergenic
1110950650 13:81485818-81485840 TTCACATGATAGAAGGGTCAAGG - Intergenic
1111197842 13:84896986-84897008 CTCAGATCAGAGAAGTGGCAGGG - Intergenic
1111311496 13:86493130-86493152 CTCACATGATGGAAGAGGCAAGG - Intergenic
1111381167 13:87454703-87454725 CTCATATGGAAGAAGGGACAAGG - Intergenic
1112028920 13:95439294-95439316 CTCACATGGTGGAAGGGGCAAGG + Intronic
1112251466 13:97784464-97784486 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1112283439 13:98082827-98082849 CTCATATGGTAGAAGGGACAAGG - Intergenic
1112829285 13:103428870-103428892 CTCTCATGGTGGAAGGGACATGG + Intergenic
1112853488 13:103735461-103735483 CTCTGATGATGGCAGGGACTGGG + Intergenic
1112884032 13:104147014-104147036 CTCACATGGTAGAAGGAAGAAGG + Intergenic
1113035844 13:106047763-106047785 CTCACATGATGGAAGGGGCAAGG - Intergenic
1113492573 13:110703996-110704018 CTCACATGGTAGAAGGTAGAGGG - Intronic
1113501542 13:110779362-110779384 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1114084300 14:19228198-19228220 CTCACATGACAGAAGGGATGAGG - Intergenic
1114570037 14:23660507-23660529 CTCAGATGAGAGCCAGGACAGGG + Intergenic
1114731291 14:24995191-24995213 CTCACATGGTAGAAGGAACAAGG + Intronic
1116054061 14:39840733-39840755 CTCACATAGTGGAAGGGACAAGG - Intergenic
1116082807 14:40197999-40198021 CTGAGATGATATAAGTGAAATGG - Intergenic
1116429436 14:44828903-44828925 CTCACATGACAGAAAGGGCAAGG - Intergenic
1116790142 14:49330775-49330797 CTCACATGATACAAGAGGCAAGG + Intergenic
1117287814 14:54304263-54304285 CTCATATGGCAGAAGGGGCAAGG - Intergenic
1117679204 14:58185832-58185854 CTCACATGGTGGAAGGGGCAAGG - Intronic
1117820176 14:59640708-59640730 CAGAAATGAAAGAAGGGACATGG - Intronic
1118266017 14:64295245-64295267 CTCAGGTGGCATAAGGGACATGG + Intronic
1118620289 14:67608789-67608811 CTCACATGGTACAAGGGGCAAGG + Intergenic
1119167308 14:72505376-72505398 TTCACATGACAGAAGGGAAAGGG + Intronic
1119908169 14:78324227-78324249 ATCTGATGAGAGAATGGACATGG + Intronic
1119911472 14:78353439-78353461 CTCACATGGTGGAAGGGGCAAGG + Intronic
1120713673 14:87818161-87818183 CTCACATGATGGATGGGGCAAGG - Intergenic
1121164378 14:91777781-91777803 CTTAGCTGGTAGAAGGGGCAAGG + Intronic
1121303546 14:92890513-92890535 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1121623730 14:95369631-95369653 CTCAGATCATAGAGGGTAAAGGG + Intergenic
1121886549 14:97548245-97548267 CTCACATGGTGGAAGAGACAAGG + Intergenic
1121968057 14:98328853-98328875 CTCACATGGTAGAAGGGCCCAGG + Intergenic
1202895914 14_GL000194v1_random:10060-10082 CTCACATGACAGAAGGGATGAGG - Intergenic
1123971485 15:25511849-25511871 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1124159340 15:27254627-27254649 CTCACATGGTGGAAAGGACAAGG + Intronic
1124185727 15:27526937-27526959 CTGAGATAGTAGAAGGTACAGGG + Intronic
1124498072 15:30199909-30199931 CTCACATGGTAGAAGGCAGAAGG + Intergenic
1124615642 15:31239951-31239973 CTCAGATAATAGAAGGGCCTTGG - Intergenic
1124618124 15:31257126-31257148 CTTACATAGTAGAAGGGACAAGG - Intergenic
1124745510 15:32338761-32338783 CTCACATGGTAGAAGGCAGAAGG - Intergenic
1126124146 15:45280074-45280096 CTCACATGGCAGAAGGGACAAGG - Intergenic
1126469137 15:48988256-48988278 TTCAGATGATGGAAGAGTCATGG - Intergenic
1127040135 15:54966158-54966180 TTCACATGATAGAAGGAGCAAGG + Intergenic
1127449798 15:59105346-59105368 AGCAGATGAGAGAAGCGACAGGG - Intronic
1127542316 15:59952901-59952923 CTCAAATGGTAGAAGGGACCAGG + Intergenic
1128350586 15:66885759-66885781 CTCAAATGAAGGAAGGGGCAAGG + Intergenic
1128790312 15:70428432-70428454 CTTAGATGCTAGAAGAGCCAAGG + Intergenic
1129025140 15:72564811-72564833 CTCATATGGTGGAAAGGACAAGG + Intronic
1129485663 15:75869585-75869607 CTCACATGGTAGAAGGCAGAAGG + Intronic
1129552224 15:76465288-76465310 CTCACCTGACAGAAGGGGCAAGG + Intronic
1129753025 15:78079152-78079174 CCCAGATGATGGGAGGGACAGGG + Intronic
1129913284 15:79245720-79245742 CTGAGGTGATAGATGGGAAATGG + Intergenic
1130031483 15:80318252-80318274 CTCAGGTGGTAGAAGGGGCATGG + Intergenic
1130949806 15:88576890-88576912 CTCATATGGTGGAAGGGGCAAGG - Intergenic
1131465896 15:92654847-92654869 TGCAGATGGTAGAAGGGAGAGGG + Intronic
1131539954 15:93267663-93267685 CTCACATGGTAGAGGGAACAAGG + Intergenic
1133551935 16:6864834-6864856 CTCAGATAAAAAAAGGGAAATGG - Intronic
1135178632 16:20253633-20253655 CTCACATGACAGAAGAGGCAAGG + Intergenic
1136392420 16:29974016-29974038 CTCGGAAGAGAGAAGGGAGAGGG + Exonic
1138214686 16:55193018-55193040 CTCACATGATGGAAAAGACAAGG - Intergenic
1138693216 16:58788181-58788203 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1138694353 16:58797867-58797889 CTCATATGGTGGAAGGGGCAGGG + Intergenic
1138990182 16:62381332-62381354 CACGGATGTTAGAATGGACAAGG + Intergenic
1139064382 16:63293815-63293837 CTCTGATGATAGAATGTATAGGG - Intergenic
1139437537 16:66944951-66944973 CTCAGACGAGAGAAGAGAGAAGG - Exonic
1140231090 16:73117826-73117848 CTCATATGGTAGAAGGGGCAAGG - Intergenic
1140879860 16:79188177-79188199 CAGAGATGGGAGAAGGGACAAGG + Intronic
1140886559 16:79249456-79249478 CTCACATGGTGGAAGGGGCATGG - Intergenic
1141030037 16:80579627-80579649 CTCACATGATGGAAGGAGCAGGG - Intergenic
1141042422 16:80683774-80683796 CTCACATGATAGAAGGGGCAAGG - Intronic
1144226951 17:13158459-13158481 CTCACATGACAGAAGGCAAAAGG + Intergenic
1144671562 17:17135611-17135633 CTCACATGTTAGAAGGGGCAAGG + Intronic
1144938157 17:18916819-18916841 CTCAGATGGTGGAAGGAGCAAGG + Intronic
1145102541 17:20088904-20088926 CTCACATGGCAGAAGGGGCAAGG - Intronic
1145837530 17:27965863-27965885 CTCACATGGTGGAAGGGGCAGGG + Intergenic
1147683709 17:42274507-42274529 CACAGTTGTTAGAATGGACATGG - Intronic
1147870784 17:43586012-43586034 ATCAGATAATCTAAGGGACAGGG + Intergenic
1148097320 17:45061379-45061401 CGCAGATGATGGAAGGGAACGGG + Exonic
1148971933 17:51491254-51491276 CTCACATGGAAGAAGGGGCAAGG - Intergenic
1149200615 17:54181912-54181934 CTCACATGATGGAAGGGGCAAGG - Intergenic
1149505021 17:57187064-57187086 CTCTGTTGAGAGAAGGGGCAAGG - Intergenic
1150345722 17:64403299-64403321 CTCACATGATGGAAAGGACTAGG - Intronic
1150719033 17:67598562-67598584 CTCACATGGTAGAAGGGACAAGG - Intronic
1151532793 17:74717860-74717882 CTCACATGGTAGAAGGGGCAAGG - Intronic
1153100911 18:1468592-1468614 CTCACATGGTGGAAGGGACAAGG - Intergenic
1153132861 18:1877382-1877404 CTCACATGACAGAAGGGGGAAGG - Intergenic
1153674809 18:7447470-7447492 CTCACATGGTAGAAGGCAGAAGG + Intergenic
1154938653 18:21088769-21088791 CTCACATGGTAGAAGGCAAAAGG - Intronic
1155026368 18:21944344-21944366 CTCACATGATGGAAGGGAGCAGG - Intergenic
1155619858 18:27766214-27766236 CTTAGATGATAGCTGGTACAAGG + Intergenic
1155650922 18:28140540-28140562 CTCACATGGTAGAAGAGGCAAGG - Intronic
1156708300 18:39911020-39911042 CTCACATGATAGAAAGAGCAAGG - Intergenic
1157023375 18:43813928-43813950 CTCAGATGAAAAAATGGAAAAGG + Intergenic
1157506835 18:48232276-48232298 CTCAGAAGCTAGAAGAGGCAAGG + Intronic
1157924633 18:51749850-51749872 CTCCCATGGTAGAAGGGACAAGG + Intergenic
1159358212 18:67364435-67364457 CTCACATGGGAGAAGGGACAAGG + Intergenic
1159858657 18:73619217-73619239 CTCATATGATGGAAGGGGCAAGG + Intergenic
1160118008 18:76100111-76100133 CTCACATGATGGAAGAGGCAAGG - Intergenic
1160132652 18:76242144-76242166 CTCACATGGTAGAAGGGATGAGG - Intergenic
1161750110 19:6089599-6089621 CTCACGTGATGGAAGGGGCAGGG - Intronic
1163113524 19:15175947-15175969 CGCAGAGGACAGAAGGGGCAGGG + Intronic
1165494810 19:36146242-36146264 CTCAGATGAAAGTGGGAACATGG + Exonic
1167152002 19:47715597-47715619 GTCAAATGATGGAAGGGAGAAGG + Intronic
925483361 2:4301409-4301431 CTCACATGGTGGAAGGGACAAGG - Intergenic
926041742 2:9679216-9679238 CTCACATGGTGGAAGGGGCAAGG - Intergenic
926461195 2:13131210-13131232 CTCAGATGATACTTGGGACTTGG + Intergenic
926474073 2:13300352-13300374 CTCAAATGATAGAATGGAACAGG + Intergenic
926933893 2:18067643-18067665 CTCACATGGTGAAAGGGACAAGG - Intronic
927084686 2:19662774-19662796 CTCACATGATGGAAGGGGCAAGG + Intergenic
927326526 2:21811636-21811658 CTCACAAGATGGAAGAGACAAGG - Intergenic
928254066 2:29706841-29706863 CTCAGAAGAGTGAAGGGACTTGG + Intronic
928326369 2:30322738-30322760 CTGAGAAGAGAGAAGGGCCAGGG - Intronic
928653110 2:33422577-33422599 TTCACATGGTGGAAGGGACAAGG - Intergenic
929072014 2:38040444-38040466 CTTACATGATGGAAGGGACAAGG - Intronic
929965561 2:46532656-46532678 CTCACATGGTAGAAGGGAAAAGG - Intronic
930151643 2:48066231-48066253 CTCAGATGGTAAAGGGGATAGGG + Intergenic
930605945 2:53493172-53493194 CTCACATGGGAGAAGGGGCAAGG - Intergenic
930618887 2:53624138-53624160 CTCAAATGGTAGAAGGGATGAGG - Intronic
930656041 2:54008013-54008035 CTCAGAGGTTAGAAGCAACATGG + Intronic
931319579 2:61163139-61163161 CTTAGAAAACAGAAGGGACATGG + Exonic
931813442 2:65877213-65877235 TTCAGATGATAGAACTGAAATGG + Intergenic
932359286 2:71091317-71091339 CTCATATGGTGGAAGGGGCAAGG - Intergenic
932507440 2:72249258-72249280 CTCAAAAAATAAAAGGGACAAGG - Intronic
932656335 2:73613937-73613959 CTCAGCTGACTGCAGGGACAGGG - Intergenic
932837675 2:75052250-75052272 CTCAGATGGTGGAAGGGGCAAGG - Intronic
932889322 2:75578514-75578536 CTCACATGACAGAAGGACCAAGG - Intergenic
933104056 2:78299398-78299420 CACAGATGTTAGAATGGGCAGGG - Intergenic
933856615 2:86420292-86420314 CTTAGATGCTAGTAGGGAGATGG - Intergenic
935011224 2:99137952-99137974 CTCATATGTTAGAAGGGGCAAGG - Intronic
935266626 2:101400531-101400553 CTCTGAGTACAGAAGGGACAGGG - Intronic
936143865 2:109965856-109965878 CTCACTTGACAGAAGGGGCAAGG - Intergenic
936180547 2:110263818-110263840 CTCACTTGACAGAAGGGGCAAGG - Intergenic
936200822 2:110405613-110405635 CTCACTTGACAGAAGGGGCAAGG + Intronic
936619459 2:114080421-114080443 ATCACATGGTGGAAGGGACAAGG + Intergenic
937084596 2:119162454-119162476 CTCAGCTTAGAGAAGGGTCACGG - Intergenic
937797620 2:126042529-126042551 CTCACATGGTGGAAAGGACAAGG - Intergenic
938146726 2:128840609-128840631 CTGAGTTGACAGAAGGGGCATGG + Intergenic
938249964 2:129806985-129807007 CCCAGATCATAGAAGGCATAAGG - Intergenic
938492290 2:131767891-131767913 CTCACATGACAGAAGGGATGAGG + Intergenic
938495279 2:131794459-131794481 CTCACATGACAGAAGGGATGAGG - Intergenic
938556856 2:132432277-132432299 CTCACATGGTGGAAGGGGCAAGG + Intronic
938598485 2:132812878-132812900 CTCAAGTGGTAGAAAGGACAAGG + Intronic
939115005 2:138050423-138050445 CTCACATGATGAAAGGGGCAAGG + Intergenic
939401625 2:141702050-141702072 CCCTGATGATAGAAGGAACTGGG + Intronic
940285560 2:152029780-152029802 CTCAAATGGTAGAAGGGGCAAGG - Intronic
940372781 2:152921408-152921430 CTCACATGGTAGAAGGGGCAAGG + Intergenic
941197228 2:162467906-162467928 CTCAGGTGGTGGAAGGGGCAAGG + Intronic
941722926 2:168831234-168831256 CTCAGATGGCAGAAGGGGCTAGG + Intronic
941746194 2:169089205-169089227 TTCAGAGGACTGAAGGGACAAGG + Intronic
942003202 2:171671400-171671422 CTTTGAAGATAGAAGGAACACGG + Intergenic
942321612 2:174741313-174741335 CTCAGATGATACAGTTGACAGGG + Intergenic
942650692 2:178164348-178164370 CTCAAATGGTTGAAGGGGCAAGG + Intergenic
942718239 2:178919075-178919097 CTCACATGGTGGAAGGGGCAAGG - Intronic
943195623 2:184744478-184744500 CTCACATGGTGGAAGGGGCATGG - Intronic
943371563 2:187022981-187023003 CTGAGGTGACAGATGGGACAAGG - Intergenic
943596053 2:189857929-189857951 CCCAGAAGCTAGAAGGAACATGG + Intronic
944388779 2:199195125-199195147 CTTAAATGATAGAGAGGACAAGG - Intergenic
944577778 2:201106241-201106263 CTCATATGGTAGAAGGGGCAAGG - Intergenic
944995823 2:205292283-205292305 CTCACATGGTGGAAGGGTCAAGG - Intronic
945064015 2:205932991-205933013 CTCATATGATAGAAGGGATGAGG - Intergenic
945135312 2:206621205-206621227 CTCTGATGATATCAGGCACATGG - Intergenic
945650412 2:212551637-212551659 CTCCCATGATAGAAGGGGCAAGG + Intergenic
945664630 2:212725455-212725477 CTCGAATGTCAGAAGGGACAGGG + Intergenic
945930724 2:215852551-215852573 CTCACATGGCAGAAGGGTCAAGG + Intergenic
945940464 2:215944281-215944303 ATCAAATGATAGAAATGACAAGG - Exonic
946447913 2:219755353-219755375 CTCATATGGTAGAAGGGACAAGG - Intergenic
946907406 2:224430047-224430069 CTCAGTTGGTAGAGGGGAGATGG + Intergenic
946972352 2:225108565-225108587 CTCACATGGTGGAAGGGGCAAGG + Intergenic
947361787 2:229352847-229352869 CTCACATGGTGGAAGGGACAGGG - Intergenic
947436432 2:230076766-230076788 CTCACATGATAGAAGGGGCAGGG + Intergenic
947994965 2:234519509-234519531 CTCACATGGTGGAAGGGGCAAGG + Intergenic
948582955 2:239000333-239000355 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1169331401 20:4719309-4719331 CCCACATGGCAGAAGGGACAAGG + Intergenic
1169429131 20:5520926-5520948 CTCAGATGAAATAAGAGGCATGG + Intergenic
1169604775 20:7304930-7304952 CTCAGGTGATAGAAGACTCAGGG - Intergenic
1169635794 20:7690038-7690060 CTCACATGGTAGAAGGAAAAAGG - Intergenic
1170020091 20:11827791-11827813 TTCACATGGTAGAAGGGGCAAGG - Intergenic
1170064172 20:12292624-12292646 CTCACATGGTGGAAGGGACAGGG - Intergenic
1170353105 20:15463947-15463969 CTAAAATCATAGAAGGGACTAGG - Intronic
1170425397 20:16230202-16230224 GTCAGATGACAGAAGGGTAAAGG - Intergenic
1170552506 20:17489849-17489871 CTCACATGCTAGAAGGGATGAGG + Intergenic
1170796938 20:19556052-19556074 CTCACATGGTGGAAGGGGCAAGG + Intronic
1172168791 20:32916213-32916235 CTCACATGGTAGAGAGGACAAGG + Intronic
1172862653 20:38067415-38067437 CTCAGAGTAGACAAGGGACAGGG + Intronic
1173234174 20:41228572-41228594 CTCACATGGCAGAAGGGACCAGG + Intronic
1173574582 20:44103936-44103958 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1173589325 20:44211686-44211708 CTCAGATGGTAGGCGGGAAAAGG + Intergenic
1174144550 20:48442283-48442305 CTCAAACGACAGAAGGGGCAAGG + Intergenic
1175916676 20:62429204-62429226 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1176109788 20:63406023-63406045 CTCAGATCCCAGAAGGTACAGGG + Intronic
1176709572 21:10137692-10137714 CTCACATGACAGAAGGGATGAGG + Intergenic
1176937276 21:14881987-14882009 CTCACATGGTGGAAGGGCCAAGG + Intergenic
1177446639 21:21205860-21205882 CTCACATGGTAGAATGGACTAGG + Intronic
1177748993 21:25256587-25256609 CTCATATGATGAAAGGGACAAGG + Intergenic
1177802358 21:25840379-25840401 CTCACATGGTAGAAGGGCAAGGG + Intergenic
1178050030 21:28737016-28737038 CTCAGAAGTTAAAAGAGACAAGG + Intergenic
1179142423 21:38737767-38737789 CTCAGATTATAAAATGGATAGGG + Intergenic
1179335226 21:40445093-40445115 CTCACATGGTGGAAGAGACAAGG + Intronic
1179350051 21:40600362-40600384 CTCACATGGTGGAAGAGACAAGG + Intronic
1179607719 21:42528267-42528289 AGCAGCAGATAGAAGGGACAGGG - Intronic
1180293671 22:10865005-10865027 CTCACATGACAGAAGGGATGAGG + Intergenic
1180496476 22:15894420-15894442 CTCACATGACAGAAGGGATGAGG + Intergenic
1181411992 22:22730619-22730641 CTCACATGACAGAAGGGATGAGG - Intergenic
1182483486 22:30625351-30625373 CTCACATGGTGGAAGGAACATGG + Intronic
1182821483 22:33220601-33220623 CTCAGAGGAGAGAAGAAACAGGG - Intronic
1182931147 22:34175489-34175511 CTCACATGGTGGAAGGGCCAAGG + Intergenic
1183116374 22:35695506-35695528 CTCCCAGGATATAAGGGACAAGG + Intergenic
1183513481 22:38249574-38249596 CTCATGTGGTAGAAGGGGCATGG - Intronic
1184350168 22:43938014-43938036 CTCACACAGTAGAAGGGACAAGG - Intronic
949602972 3:5621257-5621279 CTCACAGGATGGAAGGGGCAAGG + Intergenic
949681453 3:6519248-6519270 TTCATCTGGTAGAAGGGACAAGG + Intergenic
949765484 3:7521459-7521481 TTCACATGATGGAAGGGGCAAGG - Intronic
949768845 3:7556163-7556185 CTCACGTGGTAGAAAGGACAAGG + Intronic
949865850 3:8546582-8546604 CTACTATGGTAGAAGGGACATGG + Intronic
950127395 3:10518430-10518452 CTCGGAGGTTAGAAGGGATAGGG + Intronic
951480234 3:23153113-23153135 CTCACATGGTAGAAGGGATGAGG + Intergenic
951750348 3:26028107-26028129 CTCTGAGGACAGAAGGGACTAGG - Intergenic
951890470 3:27563554-27563576 CTCAGATGGTGGAAGAGGCAAGG + Intergenic
952058515 3:29478389-29478411 CTCACATGATGGAAGTGACAAGG + Intronic
954676131 3:52316385-52316407 CACAGCTCTTAGAAGGGACAAGG - Exonic
955515653 3:59724033-59724055 CTCACATGGTGGAAGGGGCAAGG + Intergenic
955525941 3:59819912-59819934 CTCACATGGTGGAAGGGAGAAGG - Intronic
955805351 3:62728250-62728272 CCCAGATGGTAGAAAGAACATGG - Intronic
956774854 3:72556478-72556500 CTCAGATGACAGAAGGAACCAGG + Intergenic
956789688 3:72671014-72671036 CTCAGATCATAGGAGGGAATGGG - Intergenic
956840066 3:73131125-73131147 CTCAGATGATGGAAGGCACAAGG + Intergenic
956957343 3:74356124-74356146 CTCACATGGTAGAAGGGGCAAGG - Intronic
957941302 3:87007810-87007832 CTTATATGGTAGAAGGGGCAAGG - Intergenic
958124282 3:89335287-89335309 CTCAGATGATAGAAGGGACAAGG + Intronic
958189398 3:90165593-90165615 CTCACATGGTAGAAGGCAGAGGG + Intergenic
958577037 3:95964095-95964117 CTCAGATGGCAGAAGGTAGAAGG - Intergenic
958880512 3:99664104-99664126 CTCCCATCATAGAAAGGACATGG + Intronic
958891329 3:99786406-99786428 CTTACATGATAAAAGGGGCAAGG - Intronic
959518421 3:107297853-107297875 CTCACATGATGGAAGGGGCAAGG - Intergenic
959877044 3:111395371-111395393 TTCACATGGTGGAAGGGACAAGG - Intronic
960337860 3:116440223-116440245 CTCAGATGATGACAGGGAGAGGG + Intronic
960552901 3:118996119-118996141 CTCGGTTGATAAAATGGACAGGG + Intronic
962025244 3:131540888-131540910 CTCAGGTGACAGAGGGGACTCGG + Intronic
962128491 3:132647914-132647936 CTCACATGGTGGAAGGGGCAAGG + Intronic
962325976 3:134432537-134432559 CTCAGGTAAGAGAAGGGGCATGG + Intergenic
962709021 3:138070134-138070156 CTCAGAGGAGGGAGGGGACAGGG - Intronic
962928294 3:140014973-140014995 CACAGATGCTAGCAGAGACACGG + Intronic
963645463 3:147908350-147908372 CTCACATGGTGGAAGGGGCAAGG - Intergenic
964017938 3:151970664-151970686 CTCAGATCAAAGAAGAGTCAGGG + Intergenic
964092651 3:152894481-152894503 CTCGTATGACAGAAGGGGCAAGG - Intergenic
964165134 3:153695079-153695101 CTCACATGGCAGAAGGGAGAAGG - Intergenic
964323802 3:155525352-155525374 CTCACGTGACAGAAGGGGCAAGG - Intronic
965211436 3:165794547-165794569 CTCACATAGTAGAAGGGAGAAGG + Intronic
965822136 3:172695034-172695056 CTAACATGATAGAGAGGACATGG + Intronic
966239731 3:177743121-177743143 CTTACATGGTGGAAGGGACAAGG + Intergenic
966716649 3:183019460-183019482 CTCACGTGGTGGAAGGGACAAGG - Intronic
967508050 3:190276259-190276281 CTCATATGGTAGAAGGGATGAGG + Intergenic
967774916 3:193376337-193376359 CTCACATGGTAGAAGGGACAAGG + Intronic
968050956 3:195654653-195654675 CTCTGATGGAAGAAGAGACAGGG + Intergenic
968104869 3:195993685-195993707 CTCTGATGGAAGAAGAGACAGGG - Intergenic
968303164 3:197631269-197631291 CTCTGATGGAAGAAGAGACAGGG - Intergenic
969081370 4:4621180-4621202 CTCACATGGCAGAAGGGGCAAGG + Intergenic
969094344 4:4720532-4720554 CTGTGCTGATAGAAGGGAGAGGG - Intergenic
969328476 4:6458422-6458444 CTCACATGACAGAAGGGCAAGGG + Intronic
969355867 4:6625265-6625287 CTCACATGGCAGAAGGGGCAAGG + Intergenic
969441889 4:7222091-7222113 CTCAGATGATGGAATGAACTGGG + Intronic
969965234 4:10987180-10987202 CTCATATGGTAGAAGGGGCAAGG - Intergenic
970113562 4:12667775-12667797 CTCACATGGTAGAAGAAACAAGG + Intergenic
970162723 4:13205365-13205387 CTCACATGGCAGAAGGGGCAGGG + Intergenic
970207533 4:13669837-13669859 CTCATGTGACAGAAGGGACAAGG + Intergenic
970732068 4:19117463-19117485 CTCACATAGCAGAAGGGACAAGG + Intergenic
971112612 4:23605880-23605902 CTCACATGGTGGAAGGGACAAGG + Intergenic
971246684 4:24935582-24935604 CTCACGTGATGGAAGGGGCAAGG - Intronic
971412696 4:26391989-26392011 CTCACATGGCAGGAGGGACAAGG + Intronic
971480541 4:27110735-27110757 CTCAGATAGTATAAGGGACAAGG - Intergenic
971515330 4:27479140-27479162 CTCACATGAGGGAAGGGGCAAGG - Intergenic
971520286 4:27541345-27541367 CTTACATGATAGAAGCGACTGGG - Intergenic
971592349 4:28484273-28484295 CTCACATGTTGGAAGGGTCAAGG - Intergenic
971996524 4:33972554-33972576 CTCACATGACAGAAGGCAGAAGG - Intergenic
972142310 4:35976096-35976118 CTCACATGGCAGAAGGGGCAAGG + Intronic
972226146 4:37015127-37015149 CTCACATGGTGGAAGGAACAAGG - Intergenic
972803755 4:42506303-42506325 CTCACATGGTAGAAGGGGCAAGG - Intronic
972914023 4:43853616-43853638 CTCACATGGTGGAAAGGACAAGG + Intergenic
972990453 4:44817206-44817228 CTCACATGGTGGAAGGGGCAAGG + Intergenic
973801143 4:54480089-54480111 CTCACATGGTGGAAGAGACAAGG + Intergenic
973860174 4:55056080-55056102 CTCAAATGGTGGAAGAGACAAGG - Intergenic
974722155 4:65754459-65754481 CACAGATTATAGAAGGGGTAAGG + Intergenic
975421862 4:74174101-74174123 CTCACATGGCAGAAGGCACAAGG + Intronic
975645454 4:76541755-76541777 CTCAGATCTTAGAAAGGGCATGG - Intronic
975684946 4:76910456-76910478 TTTACATGATAGAAGGGGCAAGG + Intergenic
975923789 4:79424454-79424476 CTCACATGGTAGAAGGGATGAGG + Intergenic
976334697 4:83871822-83871844 CTCACATGGTAGAAGGGGCAAGG + Intergenic
976513969 4:85943418-85943440 CTCAGATGGTGGAAGGTACAAGG + Intronic
977421311 4:96803318-96803340 CTCACATGGCAGAAGGGACAAGG - Intergenic
977437866 4:97022878-97022900 CTCACATGGTAGAAGTGAAAAGG - Intergenic
977653976 4:99500966-99500988 TTCACATGGTGGAAGGGACAAGG + Intergenic
977676782 4:99756927-99756949 CTCAGATGAAAAAAGAGAAAAGG + Intergenic
977748463 4:100579857-100579879 CTCACATGGCAGAAGGGGCAAGG - Intronic
977880498 4:102198949-102198971 CTCACATGGCAGAAGGGATAAGG + Intergenic
978050347 4:104191107-104191129 CTCACATGGTAGAAGGGACAAGG + Intergenic
978365770 4:107979729-107979751 CTCACGTGATAGAAGGGACAAGG - Intergenic
978414128 4:108457709-108457731 CTCAAATGGTAGAAGGCAGAGGG - Intergenic
978494964 4:109348800-109348822 CTCACATGGTGGAAGGGGCAAGG - Intergenic
978873794 4:113613018-113613040 CTCAGATCATACAAGGACCATGG - Intronic
979174392 4:117644497-117644519 CTCACATGGCAGAAGGGGCAAGG + Intergenic
979502858 4:121460128-121460150 CCCAGAAGTTAGAAGGGATAAGG + Intergenic
979763319 4:124434405-124434427 CTCAAATGATAGACGGGAACTGG + Intergenic
980267118 4:130531201-130531223 CTCAGATGACGGAAGAGGCAAGG + Intergenic
981244010 4:142513370-142513392 CTCACATGGTAGGAGGGGCAAGG + Intronic
981274988 4:142888736-142888758 CTCACATGGCAGAAGGGGCAAGG - Intergenic
982113458 4:152077090-152077112 CTCACATGGCAGAAGGGACCAGG - Intergenic
982743198 4:159079330-159079352 CTCACATGGTGGAAGGGGCAAGG - Intergenic
982980507 4:162128457-162128479 CTCACATGGTGGAAGGGGCAAGG - Intronic
983011371 4:162551250-162551272 TTCAGGTGACAGAAGGGAAATGG - Intergenic
983477061 4:168226418-168226440 CTCACATGGTGGAAGGGGCAAGG - Intronic
983480150 4:168263654-168263676 CTCACATGGCAGAAGGGACAGGG - Intronic
983849687 4:172565084-172565106 CTCACATGGAAGAAGGGGCAAGG + Intronic
984045727 4:174796180-174796202 CTCACATGGTGGAAGGGGCAAGG - Intronic
984435962 4:179710427-179710449 CTCACATGGCAGAAGGGGCAAGG + Intergenic
984468888 4:180140071-180140093 TTCACATGATAGAAGGAGCAAGG + Intergenic
984863383 4:184259180-184259202 CTCACATGGCAGAAGGGGCAAGG - Intergenic
986164764 5:5264050-5264072 CTCAGTTGGTAGAGGGGAGATGG - Intronic
986374667 5:7117819-7117841 CTCAGATAGCAGAAGGAACAAGG - Intergenic
987544177 5:19290886-19290908 TTCACATGACAGAAAGGACAAGG + Intergenic
987700352 5:21390173-21390195 CTCACATGGCAGAAGGGGCAAGG - Intergenic
987985889 5:25145045-25145067 CTCATATGAGAGAAGGGATGAGG + Intergenic
988321940 5:29709814-29709836 CTCACGTGATGGAAGGAACAAGG + Intergenic
988752056 5:34197892-34197914 CTCACATGGCAGAAGGGTCAAGG + Intergenic
988821227 5:34888122-34888144 CTCACATGGTGGAAGGGGCAAGG - Intronic
989098548 5:37803457-37803479 CTCACTTGATGGAAGGGGCAAGG - Intergenic
989439768 5:41456731-41456753 CTCATATGGTGGAAGGGACAAGG - Intronic
989703439 5:44298317-44298339 CTCAGATGACAGAAGGGAGGAGG - Intergenic
989980478 5:50637729-50637751 CTCACATGGTGGAAGGGACAAGG - Intergenic
990148644 5:52790745-52790767 CTTAGATGGTAAAAGGGACTTGG - Intronic
990377219 5:55183574-55183596 CTCACATGGTGGAAGTGACAAGG + Intergenic
990559256 5:56967153-56967175 CTCAAATGGTAGAAGGGACAAGG - Intronic
990657626 5:57974702-57974724 CTTATATGATGGAAAGGACAAGG - Intergenic
990700164 5:58466498-58466520 CTCACATGGTGGAAGGGGCAAGG - Intergenic
990755693 5:59066824-59066846 CTCACATGGTGGAAGGGGCAAGG - Intronic
991148812 5:63341216-63341238 CTCACATGGTATAAAGGACAAGG - Intergenic
991671348 5:69051271-69051293 CTCACATGGTGGAAGGGGCAAGG - Intergenic
991739821 5:69658708-69658730 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991757678 5:69894469-69894491 CTCACATGGCAGAAGGGGCAAGG - Intergenic
991791396 5:70238449-70238471 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991819284 5:70534833-70534855 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991837081 5:70770351-70770373 CTCACATGGCAGAAGGGGCAAGG - Intergenic
991883845 5:71238791-71238813 CTCACATGGCAGAAGGGGCAAGG + Intergenic
992157934 5:73973074-73973096 CTCACATGGCAGAAGGGGCAAGG + Intergenic
992950542 5:81852961-81852983 CTCAGATGATGGAGAGGACAAGG + Intergenic
993131938 5:83909091-83909113 TTCAGATGATAGAAAAGGCAGGG + Intergenic
993488423 5:88515470-88515492 CTCACATGGTATAAGGAACAAGG + Intergenic
993978354 5:94511092-94511114 CTCATGTGGTAGAAGGGGCAAGG - Intronic
994260713 5:97655421-97655443 CTCACGTGGCAGAAGGGACAAGG - Intergenic
994634427 5:102326502-102326524 CTCAGAAGACAGAGGGGATAAGG - Intergenic
994690295 5:103010457-103010479 CTGAGAAGACAGAAGGGCCATGG - Intronic
995058582 5:107789314-107789336 CTCACATGGTGGAAGGGACAAGG - Intergenic
996294112 5:121890940-121890962 CTCAGTTGGTAGAAGGGAAGTGG - Intergenic
997107835 5:131041533-131041555 CTCACATGGTAGAAAGGGCAAGG - Intergenic
997559956 5:134837636-134837658 CTCACATGGCAGAAGGGGCAAGG - Intronic
997597853 5:135119094-135119116 CACAGGGGATAGAGGGGACAGGG - Intronic
997909389 5:137854963-137854985 CTCACATGGTAGAAGGGGCAAGG - Intergenic
998766269 5:145491292-145491314 CTCACATGGTGGAAGGGCCAAGG + Intronic
999152824 5:149437763-149437785 CCCAGAAGATGGAAGAGACAGGG - Intergenic
999774399 5:154800438-154800460 CTCAGAAGAAGGAAGGGAGAGGG + Intronic
1001117276 5:168950201-168950223 CTCACATGGAGGAAGGGACAAGG - Intronic
1001210734 5:169807942-169807964 TTCATGGGATAGAAGGGACATGG + Intronic
1001219697 5:169889931-169889953 CTAAGTTCAGAGAAGGGACACGG - Intronic
1001273309 5:170331917-170331939 CTGAGCTGATAGGAGGGAAAAGG - Intergenic
1001441587 5:171747941-171747963 TTCTCATGGTAGAAGGGACAAGG + Intergenic
1001951974 5:175822694-175822716 CTCAGCTGATAGGAAGGAGATGG - Intronic
1002579932 5:180201816-180201838 CTCACATGGAGGAAGGGACAAGG - Intronic
1002592136 5:180298174-180298196 CTCACATGGCAGAAGGGACAAGG - Intergenic
1003118588 6:3300476-3300498 CTCACATGAGGGAAGGGGCAAGG - Intronic
1003623430 6:7722800-7722822 CTCAGAATATATAAGGAACAAGG + Intergenic
1003692056 6:8364724-8364746 CTCATATGGAAGAAGGGGCAAGG - Intergenic
1003692064 6:8364772-8364794 CTCATATGGAAGAAGGGGCAAGG - Intergenic
1003877041 6:10447080-10447102 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1004271569 6:14200730-14200752 CTCACATGGTGGAAGGGACGAGG + Intergenic
1005178138 6:23071520-23071542 ATCAGATGATTGTAGGTACATGG + Intergenic
1005380477 6:25229270-25229292 CTCCAATGGGAGAAGGGACAAGG - Intergenic
1005550217 6:26904606-26904628 CTCACATGGCAGAAGGGGCAAGG + Intergenic
1005599948 6:27416453-27416475 CACAGAAGATAGAAAGGACTAGG - Intergenic
1005904882 6:30253590-30253612 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1007116445 6:39346405-39346427 CTCACATGGTGGAAGGGGCAAGG - Intronic
1007295913 6:40820388-40820410 CTCACATGGCAGAAGGGGCAAGG - Intergenic
1007299946 6:40860292-40860314 CTCAGCTGATGGGAGGGTCATGG - Intergenic
1008158507 6:48047728-48047750 CTCACATGATAGAAGGGGCAAGG - Intronic
1008413325 6:51209147-51209169 GTCATATGATAGAAAGGACGAGG - Intergenic
1008614808 6:53216465-53216487 CTCACATGGCAGAAGGGGCAGGG - Intergenic
1008764870 6:54899642-54899664 TTCAGATGAGAGAAGGGGCGGGG + Intronic
1009336902 6:62502325-62502347 CTCACATGGTAGAAGGGGCGAGG - Intergenic
1009338706 6:62526913-62526935 CTCATATGGTGGAAGGGGCAAGG - Intergenic
1009763128 6:68034811-68034833 CTCACATGGTGGAAGGGAGAAGG - Intergenic
1010247451 6:73674777-73674799 TTCACATGATAGAAGGGGCAAGG - Intergenic
1010628309 6:78166588-78166610 CTCACATGAAAGAAGGGATAAGG + Intergenic
1010673116 6:78710352-78710374 CTCACATGATGGAAAGAACAAGG - Intergenic
1010731026 6:79391512-79391534 CTCACATGATGGAAGGGGCAAGG + Intergenic
1011003956 6:82622879-82622901 CTCACATGGTAGAAGGGATGAGG - Intergenic
1011352803 6:86441162-86441184 CTCACATAGTAGAAGGGGCAGGG - Intergenic
1011488536 6:87867989-87868011 CTGAGGTAATAGAAAGGACAAGG + Intergenic
1011499808 6:87975649-87975671 CTCAGAAGATGGAAGAGGCAAGG - Intergenic
1011515650 6:88149669-88149691 TCCAGATAAAAGAAGGGACAAGG - Intronic
1012242422 6:96888595-96888617 TCCAGATGATGGAAGGGAGAAGG - Intergenic
1012448247 6:99328359-99328381 CTCATATGGTGGAAGGGCCAAGG - Intronic
1012857412 6:104518690-104518712 CTCAGATTCTAGAAGGTATAAGG - Intergenic
1012874268 6:104707693-104707715 CTCAAATGGTAGAAGGTAGAAGG + Intergenic
1013346103 6:109262244-109262266 CTCGGAAGAGAGAAGGAACAAGG - Intergenic
1013675694 6:112459389-112459411 CTCATATGGTAGAAGGGACAAGG - Intergenic
1013786712 6:113789448-113789470 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1014008132 6:116444707-116444729 CTCACATGTTGGAAGGGACAAGG - Intergenic
1014669100 6:124277732-124277754 CTCAGATTCTTGAAGGGACCTGG + Intronic
1014808942 6:125863799-125863821 CTCACATGGTAGAAGGGTGAGGG + Intronic
1015001628 6:128223673-128223695 CTCACATAATATAAGGTACATGG - Intronic
1015187093 6:130430219-130430241 CTCACATGGTAGAAGGGGGAAGG + Intronic
1015797249 6:137025316-137025338 CTCACATGTTGGAAGGGGCAAGG - Intronic
1015971755 6:138749359-138749381 CTCATATGACAGAAGGAACAAGG - Intergenic
1016029292 6:139321333-139321355 TTCATATGGTAGAAGGCACAAGG - Intergenic
1016753454 6:147657732-147657754 CTCACATGGTAGAAGGGGCATGG + Intronic
1017282706 6:152640729-152640751 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1017284273 6:152656596-152656618 CTCACATGATGGTAGGGACAAGG + Intergenic
1017852349 6:158315797-158315819 CTCACATGGTGGAAGGGGCAAGG + Intronic
1017904274 6:158746089-158746111 CTCCCATGGTAGAAGGGACAAGG + Intronic
1018219595 6:161565047-161565069 CCCAGATGAGAGAGAGGACAGGG - Intronic
1018520573 6:164645655-164645677 CTCACATGGTGGAAGGGCCAAGG - Intergenic
1019068743 6:169324495-169324517 CTTACATGGTGGAAGGGACAAGG + Intergenic
1019914240 7:4122250-4122272 TTCAGATGTTAGTAGGGCCAGGG - Intronic
1020982766 7:15092628-15092650 CTCATATGATAAAAGGCTCAAGG - Intergenic
1021367734 7:19801660-19801682 CTCACATGGCAGAAGGGGCAAGG - Intergenic
1021413655 7:20356911-20356933 TTTAGCTGATAGAAGTGACAGGG - Intronic
1021577109 7:22114851-22114873 CTCAGAAGCTGGAAGGGAAAAGG - Intergenic
1021863656 7:24932591-24932613 CTCACAGGGTGGAAGGGACAAGG - Intronic
1022809642 7:33856278-33856300 CTCAGATGGTACAAGAGGCAAGG - Intergenic
1023823347 7:43992272-43992294 CTCATATGGTGGAAGGGTCAAGG + Intergenic
1024009098 7:45252608-45252630 CTCACATGATGGAGGGGACAAGG + Intergenic
1024952220 7:54876313-54876335 CTCATGTGATGGAAGGGAGAAGG - Intergenic
1026931203 7:74223927-74223949 CTCCGAGGATAGTAGGGGCAAGG - Intronic
1027950495 7:84808955-84808977 CTCACATGGCAGAAGGGACCAGG + Intergenic
1028882379 7:95894330-95894352 CTGATATGATAGAAGGGGCAAGG + Intronic
1028892948 7:96009326-96009348 CTCAGATGCTAATGGGGACAGGG - Intronic
1029029698 7:97454587-97454609 CTCATATCACAGAAGGGGCAAGG - Intergenic
1029751607 7:102545724-102545746 CTCATATGGTGGAAGGGTCAAGG + Intronic
1029769560 7:102644815-102644837 CTCATATGGTGGAAGGGTCAAGG + Intronic
1030203449 7:106929063-106929085 CTCACATGGCAGAAGGGACAAGG + Intergenic
1030206300 7:106955368-106955390 CTCATATGACAGAAGGGGCAAGG - Intergenic
1030225837 7:107149500-107149522 CTCACATGGTGGAAGGGGCAAGG + Intronic
1030353177 7:108512975-108512997 CTTAGATGGCAGAAGGGGCAAGG - Intronic
1030367869 7:108666866-108666888 ATGAGGTGATAGAAGGGAAAAGG - Intergenic
1031020240 7:116620120-116620142 CTCACATGATGGAAGGAACAGGG + Intergenic
1031555885 7:123175554-123175576 CTCACATGATGGAAGGGGCAAGG - Intronic
1031681057 7:124675203-124675225 CTCATATGGTGGAAGGGGCAAGG - Intergenic
1031847085 7:126818957-126818979 CTCAGAAGGTGGAAGTGACAGGG - Intronic
1032197267 7:129796583-129796605 CTCCCAGGACAGAAGGGACAGGG - Intergenic
1032413979 7:131722165-131722187 CTCTGATGCTGGAGGGGACATGG + Intergenic
1033639293 7:143245746-143245768 CTCATGTGGTAGAAAGGACAGGG - Intronic
1034363675 7:150525278-150525300 CTCACATGGTGAAAGGGACAAGG + Intergenic
1034642769 7:152617943-152617965 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1034688472 7:152994943-152994965 CTCACATGATGGAAGGGATATGG - Intergenic
1034888934 7:154822360-154822382 CTCACATGGTGGAAGGGGCAAGG + Intronic
1036161797 8:6395879-6395901 CTCACATGGCAGAAGGGACAAGG + Intergenic
1036759124 8:11494852-11494874 CACAGAGGAGAGAAGGGACGTGG + Intronic
1037586912 8:20283337-20283359 TTCAGATGGTGGAAGGGACAAGG - Intronic
1038298249 8:26316738-26316760 TTGACATGATAGAAGGGACAAGG + Intronic
1038348043 8:26750158-26750180 CTCAGATAGCAGAAGGGACAAGG + Intronic
1038381272 8:27096605-27096627 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1038984426 8:32793110-32793132 CTCAAATGGCAGAAGGGCCAAGG + Intergenic
1039099745 8:33928488-33928510 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1039192170 8:34988630-34988652 CTTACATGGTAGAAGAGACAAGG + Intergenic
1039705782 8:40005992-40006014 CTCACATAGTGGAAGGGACAAGG - Intronic
1040071813 8:43194815-43194837 CTCACATGGTAGAAGAGGCAAGG - Intronic
1040433644 8:47368115-47368137 CTCACATGGTGGAAGGGACAAGG + Intronic
1041036790 8:53799800-53799822 CTCAGATGGCAGAGGGGACAGGG - Intronic
1041396868 8:57400671-57400693 CTCAGAGGATAGAAGCAAAATGG - Intergenic
1041716935 8:60941022-60941044 CTCACATGGAAGAAGGGCCATGG + Intergenic
1041730617 8:61058716-61058738 AACAGATCAAAGAAGGGACAAGG - Intronic
1041925460 8:63231325-63231347 CTCATATGGTGAAAGGGACAAGG + Intergenic
1042411413 8:68470746-68470768 CTCACATGGTGGAAGGGGCAAGG + Intronic
1043220747 8:77660458-77660480 CTCTGATAATAGAAGGAAAATGG - Intergenic
1043278884 8:78438197-78438219 CACAGATTATAGAAGGGAACAGG + Intergenic
1043337821 8:79198980-79199002 CTCACATGGTAGAAGGGATGAGG + Intergenic
1043667924 8:82841327-82841349 CTCAGATGATAAACTAGACATGG + Intergenic
1044265387 8:90175640-90175662 CTCAGACAATAGAAGGTAGAAGG - Intergenic
1044348161 8:91130886-91130908 CTCACATGGTAGAAGGGGCAAGG + Intronic
1044510635 8:93074344-93074366 CTCACATGGTAGAGGGGGCAAGG - Intergenic
1044639605 8:94364981-94365003 CTCACATGGTGGAAGGGACAAGG - Intergenic
1045186572 8:99844328-99844350 CTCACATGATGGAAGGGATGAGG + Intronic
1045859772 8:106803102-106803124 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1046177190 8:110593172-110593194 CTCACATGGTAGAAGAGGCAAGG + Intergenic
1046658594 8:116924134-116924156 CTCAGAAGATACAAGGGGAAAGG - Intergenic
1046953378 8:120039185-120039207 CTCACATGGTAGAAGGGGCAAGG - Intronic
1047003545 8:120596626-120596648 CTCAGCTGATAGCAAGGAAATGG - Intronic
1047145352 8:122192667-122192689 CTCACATGATAGAAGGGTGAGGG + Intergenic
1047778946 8:128096422-128096444 CTCAGCTGGTACAGGGGACAGGG - Intergenic
1048465556 8:134662154-134662176 CTCACATGGTGGAAGGGGCAAGG + Intronic
1048476707 8:134749449-134749471 TTCACATGGTAGAAGGGGCAAGG + Intergenic
1048635121 8:136287055-136287077 CTCACATGTGTGAAGGGACAAGG - Intergenic
1048908046 8:139107279-139107301 CTTAAATGGTGGAAGGGACAGGG + Intergenic
1049111095 8:140643982-140644004 CTCATATGGTAGAAGGGGCAAGG - Intergenic
1049291220 8:141803345-141803367 CTCACATGATGGAAGGGGTAAGG + Intergenic
1049301140 8:141871481-141871503 CTCAGATGATGGAATAGAGATGG + Intergenic
1049301620 8:141873686-141873708 CTCAGATGATGGAATAGAGATGG + Intergenic
1050093659 9:2041430-2041452 CTCACATGGCAGAAGAGACAAGG + Intronic
1050103939 9:2146194-2146216 CTCACATGGTAGAAGGGACATGG + Intronic
1050757981 9:9031807-9031829 CTCATAGGATAAATGGGACACGG + Intronic
1051062148 9:13056933-13056955 CTCACATGCTGGAAGGGACAAGG + Intergenic
1051266735 9:15316511-15316533 CTCAAATGGTAGAAGGGGCAAGG - Intergenic
1051350644 9:16195292-16195314 TTCAGAGGTTAAAAGGGACACGG - Intergenic
1051605692 9:18916047-18916069 CTCACATGACAGAAGGTAGAAGG - Intergenic
1051662681 9:19440494-19440516 CTCACATGGTAGAAGGGCCAAGG - Intronic
1051910703 9:22152190-22152212 CTCACATAGTAGAAGGGGCAAGG - Intergenic
1051964839 9:22815276-22815298 CTCACATGGTAGAAGGCAGAGGG - Intergenic
1052083413 9:24234778-24234800 CTCACATGGTGAAAGGGACAAGG + Intergenic
1052234310 9:26191619-26191641 CTCATATGACAAAAGGGCCAGGG + Intergenic
1052378733 9:27746138-27746160 CTCACATGGTGGAAGGAACAAGG - Intergenic
1053684368 9:40507511-40507533 CTGAGATGACTGAGGGGACAGGG + Intergenic
1053934337 9:43135797-43135819 CTGAGATGACTGAGGGGACAGGG + Intergenic
1054279357 9:63117442-63117464 CTGAGATGACTGAGGGGACAGGG - Intergenic
1054297462 9:63342975-63342997 CTGAGATGACTGAGGGGACAGGG + Intergenic
1054395480 9:64647483-64647505 CTGAGATGACTGAGGGGACAGGG + Intergenic
1054430126 9:65152683-65152705 CTGAGATGACTGAGGGGACAGGG + Intergenic
1054500257 9:65868849-65868871 CTGAGATGACTGAGGGGACAGGG - Intergenic
1054702237 9:68424406-68424428 CTCACATGGTGGAAGGGGCAAGG + Intronic
1055618206 9:78095105-78095127 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1056423476 9:86453174-86453196 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1056618552 9:88190500-88190522 CACAGATGATAGAATAGGCAAGG - Intergenic
1056753677 9:89368991-89369013 CCCAGATAACAGAAGAGACATGG + Intronic
1056987127 9:91373664-91373686 CTCACATGATAGAAGGGGCAGGG + Intergenic
1057468758 9:95339091-95339113 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1057522149 9:95768640-95768662 CTCACACGATGGAAGGGGCAAGG - Intergenic
1057606774 9:96504133-96504155 CTCAGAGGAAAGGAAGGACAAGG - Intronic
1058188424 9:101883896-101883918 CTCAAATGGTAGAAGGGGCAAGG - Intergenic
1059502680 9:114768473-114768495 CTCACATGGTAAAAGGGACAAGG - Intergenic
1059535221 9:115074368-115074390 CTCACAGGACAGAAGGGGCAAGG - Intronic
1059599645 9:115762879-115762901 CTCACATGGTAGAAGGCAGAAGG + Intergenic
1059632263 9:116137304-116137326 CTCAGAAGTTAGTAGAGACAAGG - Intergenic
1059898072 9:118890943-118890965 CTCATGTGTTGGAAGGGACAAGG - Intergenic
1059921060 9:119160209-119160231 CTCACATGGTGGAAGGGGCAAGG - Intronic
1060561367 9:124547153-124547175 CTGAGAAGATAGAAGAGCCATGG - Intronic
1060607772 9:124932835-124932857 CTCACATGGTGGAAGGGGCAAGG + Intronic
1202794331 9_KI270719v1_random:106659-106681 CTCACATGACAGAAGGGATGAGG + Intergenic
1185828584 X:3276623-3276645 CTCACATGGTAGAAGGGGCAAGG - Intronic
1185845325 X:3432503-3432525 CCCACATGGTGGAAGGGACAAGG + Intergenic
1185847086 X:3447736-3447758 CCAAGATGGCAGAAGGGACACGG + Intergenic
1185969010 X:4641010-4641032 CTCACATGCTGGAAGGGACGAGG - Intergenic
1186035915 X:5423534-5423556 CTCACGTGGTAGAAGGGGCAAGG - Intergenic
1186054866 X:5639400-5639422 CTCACATGGTGGAAGGGACAAGG - Intergenic
1186082788 X:5951693-5951715 CTCACATGATAAAAGGGACGAGG + Intronic
1186096825 X:6111324-6111346 CTCACATGTTGGAAGGGACAAGG - Intronic
1186174513 X:6910908-6910930 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1186274978 X:7928718-7928740 CTCAGATCAGAGATGGGACCTGG - Intergenic
1186275316 X:7931982-7932004 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1186281571 X:7998796-7998818 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1186367289 X:8909083-8909105 TTCACATGATGGAAGGGACGAGG + Intergenic
1186695209 X:12023135-12023157 CTCATATGGTAGAAGGGATGAGG - Intergenic
1187207416 X:17196500-17196522 CTCACATGATGGAAGGAGCAAGG - Intergenic
1187508944 X:19900326-19900348 CTCAGAAAATAGAAGGAAAACGG - Intergenic
1187569716 X:20488591-20488613 CTCACACGATGGAAGGGCCAAGG - Intergenic
1187762067 X:22598314-22598336 TTCACATGGTGGAAGGGACAAGG - Intergenic
1187974577 X:24692430-24692452 CTCACATGGAAGAAGGGGCAAGG + Intergenic
1188172401 X:26943636-26943658 CTCACATGGTAGAAAGGGCAAGG - Intergenic
1188204325 X:27334466-27334488 CTCAGGTGAAAAAAGAGACAAGG + Intergenic
1188746445 X:33850640-33850662 CTCACATGTCAGAAGGGGCAAGG + Intergenic
1188932209 X:36125295-36125317 CTGACATGATAGAAGGGATTTGG - Intronic
1190397950 X:50003691-50003713 CTGAGATGGGAGAAAGGACATGG - Intronic
1192119175 X:68438804-68438826 CTCACATGGTGGAAGGGATAAGG - Intergenic
1192305137 X:69951229-69951251 CTCACATGATGGAAGGCAGAAGG - Intronic
1192796128 X:74425206-74425228 CACAGAAGTTAGAAGGGATATGG + Intronic
1192867629 X:75152345-75152367 CTCATGTGGTAGAAGAGACAAGG - Intronic
1193136955 X:77983015-77983037 CTCACATGGTGGAAGGGACAGGG + Intronic
1193370821 X:80694840-80694862 CTCAGATGATACTTTGGACATGG + Intronic
1194439470 X:93913683-93913705 CTCAGATGAGAAGAGGGCCAGGG - Intergenic
1194812619 X:98404568-98404590 CTCACATGGCAGAAGGGACAAGG + Intergenic
1195430320 X:104781978-104782000 CTCACATGGCAGAAGGGGCAAGG - Intronic
1195770875 X:108349814-108349836 TACAGATAATAGAAGGGATATGG + Intronic
1196076738 X:111586073-111586095 CTCACATGGTGGAAGGAACAAGG - Intergenic
1196327155 X:114420028-114420050 CTCACATGGTAGAAGGGCAAAGG - Intergenic
1197914176 X:131516859-131516881 CTCACATAGTGGAAGGGACAAGG - Intergenic
1198449379 X:136751669-136751691 CTTACATGGTGGAAGGGACAAGG - Intronic
1198499171 X:137225602-137225624 CTCACATGATGGAAAGGGCAAGG - Intergenic
1199208285 X:145174905-145174927 CTCATATGGTGGAAGGGAAAAGG - Intergenic
1199279838 X:145988414-145988436 TTCACATGGCAGAAGGGACAAGG - Intergenic
1199300969 X:146213561-146213583 CTAACATCATAGAAGAGACATGG - Intergenic
1199550843 X:149059861-149059883 TTCAGATGATAGAAAGAGCAAGG + Intergenic
1199606614 X:149584097-149584119 CTCAGCTGACACAAGGGGCAGGG + Intronic
1199632509 X:149785271-149785293 CTCAGCTGACACAAGGGGCAGGG - Intronic
1199884095 X:152001916-152001938 CTTACATGGTAGAAGGGGCAAGG - Intergenic
1199910914 X:152285764-152285786 CTCACATGATGGAAGGGGCTAGG + Intronic
1199949423 X:152695640-152695662 CTCACATGGAAGAAGGGGCAAGG - Intergenic
1199951597 X:152711301-152711323 CTCACATGCAAGAAGGGATAAGG - Intergenic
1199958086 X:152757147-152757169 CTCACATGCAAGAAGGGATAAGG + Intergenic
1199960253 X:152772809-152772831 CTCACATGGAAGAAGGGGCAAGG + Intergenic
1200374418 X:155765002-155765024 CTCACATGATGGAAGTGCCAAGG + Intergenic
1200817393 Y:7547900-7547922 CCAAGATGATGAAAGGGACATGG - Intergenic
1200945070 Y:8826804-8826826 CTGGGATGATAGAGGGGAGAGGG + Intergenic
1201148987 Y:11084767-11084789 CTCACATGACAGAAGGGATGAGG - Intergenic
1201283108 Y:12357970-12357992 CTCTGATGATTGATGGGACCAGG - Intergenic
1201446686 Y:14064600-14064622 CTCACATGGTAGAAGGGGAAAGG - Intergenic
1201637365 Y:16139084-16139106 CTCACATGATGGAAGGGACAAGG + Intergenic
1201674382 Y:16562790-16562812 CTCATATGGTACAAGGGGCAAGG - Intergenic
1201688197 Y:16731440-16731462 CTCACATGGTAGAAGGGGCCAGG + Intergenic
1201746884 Y:17385945-17385967 CTCAAATGGTAGAAGGGGCAGGG - Intergenic
1201906412 Y:19090256-19090278 CTCACATGGTGGAAGGAACAAGG - Intergenic