ID: 958130463

View in Genome Browser
Species Human (GRCh38)
Location 3:89413541-89413563
Sequence AAAACCTATTTGGCTAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958130461_958130463 3 Left 958130461 3:89413515-89413537 CCATAGCTGTGCTGATCGTGTGT 0: 1
1: 0
2: 0
3: 7
4: 63
Right 958130463 3:89413541-89413563 AAAACCTATTTGGCTAAATAAGG 0: 1
1: 0
2: 2
3: 21
4: 227
958130460_958130463 4 Left 958130460 3:89413514-89413536 CCCATAGCTGTGCTGATCGTGTG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 958130463 3:89413541-89413563 AAAACCTATTTGGCTAAATAAGG 0: 1
1: 0
2: 2
3: 21
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958130463 Original CRISPR AAAACCTATTTGGCTAAATA AGG Intronic
900034848 1:398700-398722 AAAATCTATTTGGCTCAGAAAGG - Intergenic
900055678 1:628578-628600 AAAATCTATTTGGCTCAGAAAGG - Intergenic
904462485 1:30688460-30688482 AAATCCTATGTGTCTAAATCTGG + Intergenic
905049299 1:35035574-35035596 CAATCCTATATGACTAAATAAGG - Intergenic
906452803 1:45966356-45966378 TTAACTTATTTGGGTAAATAAGG + Intronic
908074645 1:60502740-60502762 GAAACCTATTTGGCTATCTCAGG + Intergenic
909709396 1:78628895-78628917 AAAACTTGTTTGGTTAAATGTGG - Intronic
909709961 1:78637456-78637478 AAAACCTATGTGGGTAGACAGGG + Intronic
909811489 1:79936741-79936763 AAAATCTATTTACCTAAACATGG + Intergenic
911707185 1:101026871-101026893 AAGAAATATTTGCCTAAATAAGG - Intergenic
911847169 1:102768834-102768856 CAAATATATTTGGCTTAATATGG + Intergenic
912621480 1:111163785-111163807 AAAATTTATTTTGCTTAATAAGG + Intronic
916784358 1:168074054-168074076 AATACCTATTTGTATAATTAAGG + Intronic
917912596 1:179666060-179666082 AAAACATGTTTGTCTACATAGGG - Intronic
918719384 1:187833668-187833690 AAAACCTATATAGCTGAAAAGGG + Intergenic
919049678 1:192498794-192498816 AAAACCTTTTTGTCTAGCTAAGG - Intergenic
923080783 1:230652548-230652570 TCAACCCATTTGGCTAAATACGG + Intronic
1064361570 10:14670276-14670298 ATAAGCAATTTGGGTAAATAAGG + Intronic
1067071260 10:43134063-43134085 AAAAGCTATTTGGCTTTCTAAGG - Intergenic
1068676231 10:59772329-59772351 AAAAACTATTAGGCTAATTAAGG - Intergenic
1068773904 10:60851238-60851260 AAAATCTGTTTGGCTATGTAAGG + Intergenic
1070037285 10:72739005-72739027 AAAACATATTTGGTTATGTATGG + Intronic
1070371312 10:75784889-75784911 AAAACCTATTTGCTTCAATATGG - Intronic
1071081368 10:81816122-81816144 AAAACCTATTTGACTTAATTTGG - Intergenic
1071671841 10:87616276-87616298 AAAACCCTTTTTTCTAAATAAGG - Intergenic
1072396241 10:95045223-95045245 AAATGCTATTTGACCAAATAGGG - Intronic
1072814262 10:98489226-98489248 AAAATCCATCTGGCCAAATATGG - Intronic
1075503640 10:123002106-123002128 CAAACATATTTAGCCAAATAAGG + Intronic
1078078300 11:8181416-8181438 AAAGCGTAATTGGGTAAATAAGG + Intergenic
1080077205 11:28164466-28164488 AAATCATGTATGGCTAAATATGG - Intronic
1082755881 11:57075921-57075943 ACAAACTATTTGGTTCAATAGGG + Intergenic
1082984505 11:59156896-59156918 AAAGCATTTTTGTCTAAATAAGG - Intergenic
1083368217 11:62156204-62156226 AAAAGCTATTAGGATTAATATGG + Intergenic
1084538377 11:69772148-69772170 CAATCCTTTTTGGCTACATATGG + Exonic
1086251437 11:84819743-84819765 CAAAGCCATTTGGCTAAATCTGG - Intronic
1088630363 11:111768467-111768489 AAAAACAATTTAGCTAAACATGG + Intergenic
1091012379 11:132014878-132014900 AGAAGCTTTTTGGCTTAATATGG + Intronic
1092134013 12:6132964-6132986 AAAACCTTTTTGTCTAGCTAAGG + Intergenic
1092796502 12:12115146-12115168 AAAACCTATCTGGGGAAAAAAGG + Intronic
1092858668 12:12699401-12699423 AAAATTTATTTGGCTTATTAGGG - Intergenic
1093695486 12:22155479-22155501 AAAGCCTCTTTTGCTATATAAGG + Intronic
1094084069 12:26569654-26569676 AAAACCTATTAGGAGAAATAAGG + Intronic
1094668915 12:32549576-32549598 AAAGCCTATTTGCCTAATTCAGG - Intronic
1094780276 12:33784159-33784181 AAAAACTATTTGTGGAAATATGG - Intergenic
1095718776 12:45377389-45377411 ATAACGTATCTGGCCAAATAAGG - Intronic
1095771617 12:45965823-45965845 ATTCCCTATTTGGTTAAATAAGG + Intronic
1096552147 12:52379956-52379978 AAAACCTATTTGCCATAAAAAGG + Intronic
1098990521 12:77060538-77060560 AAAAAGAAGTTGGCTAAATATGG - Intronic
1100078695 12:90822381-90822403 AAAACGTATTTTCCTAAACAGGG + Intergenic
1101543538 12:105686937-105686959 AAAAACTAGTTGGCTGTATATGG + Intergenic
1101581598 12:106046962-106046984 AAAGCATATTTCACTAAATAGGG + Intergenic
1101991817 12:109491970-109491992 AAAACCTATTTGGAAAATGATGG + Intronic
1106442753 13:29792378-29792400 AAAACCAATTTCTCTAAAGAGGG + Intronic
1107336204 13:39358544-39358566 AAAACCTCTTTAGTTTAATAAGG - Intronic
1107758114 13:43647746-43647768 AAAATCTATTTTGCCATATAAGG - Intronic
1108929632 13:55801373-55801395 AAAATATATTTGTATAAATAAGG - Intergenic
1110099734 13:71583027-71583049 AAAAACTATGTTTCTAAATAAGG + Intronic
1110655788 13:77997166-77997188 AAAGTCTATTTTGCTATATAAGG + Intergenic
1111034460 13:82654604-82654626 AAACTCTATTTGAATAAATATGG - Intergenic
1115225722 14:31099618-31099640 AAAAGCTATTTGGCTAAATCAGG + Intergenic
1116558559 14:46346078-46346100 AAAACTTCTTTGACTCAATAAGG - Intergenic
1117862223 14:60104462-60104484 GAAAGGTATTTTGCTAAATATGG + Intronic
1118363048 14:65071887-65071909 AAAACCAATTTGGCTAAGCCAGG - Intronic
1118990602 14:70793750-70793772 AAAACCTATTTGGAGATGTAAGG + Intronic
1121364587 14:93297018-93297040 AAAATCTATCTGACTAAATGGGG + Intronic
1123969847 15:25497326-25497348 AATACCAATATGGCTAAATCTGG - Intergenic
1125781911 15:42276863-42276885 AAAACCTATTTGGTATAAAAAGG - Intronic
1125927870 15:43578034-43578056 AAAACCTATTTATGTAAATTAGG + Intronic
1125941013 15:43677599-43677621 AAAACCTATTTATGTAAATTAGG + Intergenic
1134425985 16:14145618-14145640 AAAAGTTAATTGCCTAAATATGG - Intronic
1134527947 16:14958741-14958763 AAAAATTATTTTGCTAAATCTGG + Intergenic
1136135247 16:28252688-28252710 ATAACCTTTTTGGTTAAATATGG + Intergenic
1136135250 16:28252715-28252737 ATAACCTTTTTGGTTAAATATGG + Intergenic
1137311659 16:47266855-47266877 AAATTCTATTTGGCCAAAAAAGG + Intronic
1138022640 16:53498357-53498379 ACAAACTATTTGGTTAAATTAGG - Intronic
1138239108 16:55412121-55412143 AAAGACTCTTTGTCTAAATATGG - Intronic
1138755368 16:59477815-59477837 AAAACATCTTTGGGTAAATTTGG + Intergenic
1141294592 16:82755483-82755505 ATAACCAATTTGACAAAATATGG - Intronic
1141329960 16:83101950-83101972 AAAGTCTATTTGGCCATATAAGG - Intronic
1142910920 17:3090035-3090057 AAAACTTATTTTTCTAAAAATGG - Intergenic
1143891958 17:10108974-10108996 AAAACCTTTTTAGTTTAATATGG - Intronic
1144102502 17:11954254-11954276 AAAAACTATTTGAAGAAATAAGG + Intronic
1155077763 18:22376212-22376234 AAAAACTTTTTGGCTAAGTAGGG + Intergenic
1155352780 18:24923283-24923305 ACAACCTATTTGCCTAAGTTGGG - Intergenic
1156041444 18:32827679-32827701 CAAACCTATTTGTCTAAATAAGG - Intergenic
1156329547 18:36106747-36106769 AGAAACTATTTGGATAAATGAGG + Intergenic
1156413236 18:36857232-36857254 AGAACCTATTTGGTAAAATAAGG - Intronic
1156853410 18:41754833-41754855 AAAAACGATTTGGCTAAATCAGG + Intergenic
1157016005 18:43714237-43714259 AAAATTAATTTGGCTAAATTTGG - Intergenic
1158344613 18:56503632-56503654 AAAACCTGTTTGGATCACTACGG - Intergenic
1158756648 18:60332989-60333011 AAAACATATTTGGGGAAATAAGG + Intergenic
1159667138 18:71175439-71175461 AAAAGCTATTTCGCTATTTATGG + Intergenic
1159806521 18:72963986-72964008 AAAGCCTATTTGGGTAATTTGGG + Intergenic
1160950502 19:1664730-1664752 AAAACATTTTTGGCCAGATATGG - Intergenic
1163277106 19:16291814-16291836 AAAAGCTAAGTGGCTAAGTATGG - Intergenic
1163486811 19:17592641-17592663 AAAAATTATTTGGCTGAACACGG + Intergenic
1166625842 19:44355222-44355244 GAAGCCTATTTGGTTAAACATGG + Intronic
1167401882 19:49278259-49278281 AAAAGCCATTTGGCAAAATGCGG + Intergenic
926521623 2:13922865-13922887 AAGACCTTTTTGGCTAAAAAGGG + Intergenic
928721582 2:34127280-34127302 AAGACCTATGTCCCTAAATAAGG - Intergenic
930689247 2:54342594-54342616 AAAACCTATGTGGCTGCATAGGG - Intronic
932372432 2:71202137-71202159 CAAATCTATTTGGTTAAACATGG + Intronic
933126038 2:78607542-78607564 AATAAATATTTGCCTAAATACGG + Intergenic
933290944 2:80437630-80437652 TAAAGCTATTTGGTAAAATATGG + Intronic
933613719 2:84462701-84462723 AAGACCTATCTAGCTAACTAAGG - Intergenic
933742734 2:85547513-85547535 AAAAAGTATTTTTCTAAATATGG - Exonic
934020346 2:87944505-87944527 ATAACCTTTTTGGGTAATTATGG - Intergenic
935025180 2:99269854-99269876 AAAACCAAGTTGGATAAACATGG + Intronic
937662079 2:124442439-124442461 ACAATCTATTTCACTAAATAAGG + Intronic
937820051 2:126300199-126300221 CACACATATATGGCTAAATAAGG + Intergenic
938547604 2:132348921-132348943 GAAGCCTATTTGGTTAAACATGG - Intergenic
938615335 2:132991925-132991947 AAATTCTATTTTTCTAAATAAGG - Intronic
939039861 2:137175248-137175270 ATAGCCTATTTGGCAAATTATGG - Intronic
939414647 2:141879277-141879299 AAAATATACTTGGGTAAATAAGG + Intronic
940431898 2:153601900-153601922 AAATCCCATTTGACTACATAGGG - Intergenic
940540920 2:155016171-155016193 AAAACCTTTTTGGCAAAAAAAGG + Intergenic
941191107 2:162383546-162383568 AAAACCTTTGTAGCTGAATATGG + Intronic
941952160 2:171166547-171166569 AAAACATTTTAGGATAAATATGG - Intronic
943354906 2:186841472-186841494 AAAACATATTTGGCAATACATGG + Intronic
943459198 2:188149260-188149282 AAAACCTATTTAACAAAGTAAGG + Intergenic
943981395 2:194555939-194555961 GAAACCTAATATGCTAAATAGGG - Intergenic
944298397 2:198093503-198093525 AAAACTGATTTGGATGAATAAGG + Intronic
944338665 2:198568477-198568499 AATACCTTATTGGCCAAATATGG - Intronic
945687863 2:212994328-212994350 AAAACTTATTTGGAGAAACAAGG - Intergenic
947190009 2:227494391-227494413 AAAACTTATGTGACTGAATATGG - Intronic
948308047 2:236964326-236964348 AAAACCCATTGGGCTTAATGTGG + Intergenic
1169531520 20:6490123-6490145 AGAACATATTTGGGTAAATGGGG - Intergenic
1170129421 20:13002568-13002590 AAATCCTTTGTGGCTAAAGAGGG - Intergenic
1170366665 20:15605657-15605679 AATACCTATTTGGAAAAATCTGG + Intronic
1172395748 20:34603478-34603500 GAAACCTACTTGGCTAAATTAGG - Intronic
1175692719 20:61077086-61077108 AAAACCTCTTTTTCCAAATAAGG + Intergenic
1176701093 21:10050836-10050858 AGAAACTATATGGCTAAATGTGG + Intergenic
1177534582 21:22407190-22407212 TAAAGATATTTGGCTACATAAGG + Intergenic
1178736946 21:35161089-35161111 CAAATCTATTTGGTTAGATATGG + Intronic
949739780 3:7218302-7218324 AAAACCTGTTTGGCAATAAAGGG + Intronic
950555551 3:13693674-13693696 AAACCCTATTTGGCAAAGCATGG + Intergenic
950984905 3:17351873-17351895 AAAACAAAGTTGGCTAAATATGG + Intronic
951055985 3:18146744-18146766 AAAACCTGTATGGCTAAGCATGG + Intronic
956861886 3:73332760-73332782 ACAACGTATCTGGCTAAATGTGG + Intergenic
957424329 3:80018374-80018396 AAAACCTGTTTGGATTAATATGG + Intergenic
958130463 3:89413541-89413563 AAAACCTATTTGGCTAAATAAGG + Intronic
959734000 3:109636741-109636763 AAAACCTATATCTCCAAATAAGG + Intergenic
962247126 3:133805079-133805101 AACACCTACCTGGCTGAATAGGG + Intronic
965489823 3:169322304-169322326 AACACCTATTTGGCCAGATTGGG + Intronic
966572749 3:181464605-181464627 GAATCCTTTTTGGCTACATAAGG - Intergenic
967040410 3:185686980-185687002 AAAACCTCTTGGGTTAAATGAGG + Intronic
968013783 3:195307346-195307368 AAAACCTAAGTGGAAAAATATGG - Intronic
970308181 4:14754408-14754430 AAAATCTAATTGGCTAAGTTGGG - Intergenic
971253848 4:24995911-24995933 AAAACTGATATGGATAAATATGG + Intergenic
971594007 4:28504844-28504866 AAAAAGTATTTGGCTTAATGAGG - Intergenic
975041512 4:69749875-69749897 AAAAACTGGTTGGCAAAATAAGG - Intronic
975127374 4:70797966-70797988 AAAACCTCATTGGAAAAATAGGG - Intronic
975427137 4:74243369-74243391 CATTCCTATTTGGCTAAATGGGG + Intronic
976799145 4:88968718-88968740 AATACCTATTTTGCTGGATATGG - Intronic
977579836 4:98713232-98713254 TATCCCTATTTGGCTAAAGAAGG - Intergenic
977988132 4:103409543-103409565 GACATGTATTTGGCTAAATATGG + Intergenic
978475862 4:109129116-109129138 AAAAATTATTTGACAAAATAAGG - Intronic
979092534 4:116503748-116503770 AAACCAAATATGGCTAAATATGG - Intergenic
979193645 4:117894105-117894127 AAAACCTAAGTTGTTAAATACGG + Intergenic
979981532 4:127262319-127262341 AAAAGGTAATTTGCTAAATAGGG + Intergenic
980755978 4:137161205-137161227 AAAAATTAATTGGCTAACTATGG - Intergenic
982712570 4:158771467-158771489 AACTCCTATTTGGCAAAATCTGG - Intronic
983113041 4:163777266-163777288 AAAAGCTATTTTGCTAATGATGG + Intronic
983142664 4:164172042-164172064 ACAACCTCTGTGGCTCAATATGG + Intronic
983813715 4:172096726-172096748 AAAACATGAATGGCTAAATAAGG - Intronic
984359866 4:178715119-178715141 AAAACATATTTGGCTAGAAGGGG - Intergenic
987421165 5:17721475-17721497 AGAACCTATTAGGCAAAGTAGGG + Intergenic
990242777 5:53832519-53832541 AAAACCTAATTGGATAACTGTGG + Intergenic
990828857 5:59933948-59933970 AAAACCTATTTGATTATAGAAGG + Intronic
991563736 5:67982968-67982990 AAAACATATATGGGTAAAAAGGG - Intergenic
992861729 5:80918155-80918177 AAAACAAATTTAGCTAGATAGGG + Intergenic
993976941 5:94494023-94494045 GAAACCTAAGTGGCTAAAAAGGG + Intronic
994378781 5:99045057-99045079 TAAATCTATGTGTCTAAATAAGG - Intergenic
994545405 5:101161000-101161022 AAAACCTTTTTTTCTAACTAAGG + Intergenic
995390319 5:111633642-111633664 AAAAGGTAATTGGGTAAATATGG + Intergenic
997071286 5:130625518-130625540 AAAAGCTATTTGGCTGTCTAAGG - Intergenic
997331063 5:133062151-133062173 AAAACCTATATTCCTTAATATGG - Intronic
998646424 5:144067248-144067270 AAAAACTATTAAGCAAAATAGGG + Intergenic
998953720 5:147416981-147417003 AAATCCTATTTGGCCAAACTAGG - Intronic
1000446392 5:161327497-161327519 AAAGCCTATGTGCCTAAAGAAGG - Intronic
1001784032 5:174396419-174396441 AAAACATCTTAGGCTACATATGG + Intergenic
1002738971 5:181420171-181420193 AAAATCTATTTGGCTCAGAAAGG + Intergenic
1003390620 6:5709849-5709871 AAAACCCACTTGGCTAACAAGGG - Intronic
1008318372 6:50075531-50075553 AAAACCAAGTTGGCAAACTATGG + Intergenic
1012587311 6:100939676-100939698 AAAACATATATGGCTAAGTGAGG - Intergenic
1013753559 6:113435172-113435194 AAAACCTTTTTGGCAACATTGGG + Intergenic
1013767114 6:113587776-113587798 AAAACCAATTTTGGTGAATAAGG - Intergenic
1014749655 6:125241042-125241064 AAAAGTTATTTGACAAAATATGG - Intronic
1015431370 6:133133571-133133593 AAAACCTATTGGGCTCAAGTGGG - Intergenic
1015523657 6:134155309-134155331 TAAATCCAATTGGCTAAATAAGG - Intergenic
1016119465 6:140329002-140329024 TAAACCTATGTGGCCAAAGAGGG - Intergenic
1016258593 6:142139945-142139967 AAAAGCTCTTTGGTGAAATAAGG + Intergenic
1016633102 6:146255187-146255209 AAAACCTATTTGGATATTTTTGG + Intronic
1017435659 6:154413518-154413540 AAAACCTATGTGGCCAGGTATGG - Intronic
1018278196 6:162155827-162155849 AACACAAATTTGGCTAAAGAAGG + Intronic
1018506135 6:164471682-164471704 AAAAGCTATTTGGCTAAAGCAGG - Intergenic
1019244079 6:170695723-170695745 AAAATCTATTTGGCTCAGAAAGG + Intergenic
1020883198 7:13789765-13789787 AACACCTAATAGGCTACATATGG + Intergenic
1023287674 7:38636029-38636051 CAAACCTATTTGGTAAAATTGGG - Intergenic
1024811532 7:53218008-53218030 ACTACTTATTTGGATAAATATGG + Intergenic
1027197519 7:76040876-76040898 AAAAGCTATTTATCTAAATATGG + Intronic
1027370667 7:77506290-77506312 AAACCATATTAGGCAAAATAGGG + Intergenic
1027701381 7:81473840-81473862 AAAACCTAATTGGAAAAATATGG + Intergenic
1028127111 7:87126085-87126107 AAAACCTATATGGATAGACACGG + Intergenic
1028354648 7:89891415-89891437 ATCACATATTTGGCAAAATAGGG + Intergenic
1028895992 7:96042692-96042714 AAAACCTCTTTGGCCACCTATGG + Intronic
1029018710 7:97341416-97341438 AAAACCTAAATGTCTAAAAATGG - Intergenic
1031170109 7:118282537-118282559 TCAACCTAGTTGTCTAAATATGG - Intergenic
1031474033 7:122201141-122201163 AAAATCTATTGAGCAAAATAAGG + Intergenic
1031841800 7:126751175-126751197 AAAACCAATGTGACTAAATAAGG + Intronic
1035214085 7:157351674-157351696 AAAACTTGTTTGGCTGGATATGG + Intronic
1035504046 8:112437-112459 AAAATCTATTTGGCTCAGAAAGG - Intergenic
1036491465 8:9230015-9230037 CAAAGCTATAAGGCTAAATAGGG + Intergenic
1041333474 8:56753319-56753341 AAAACTTATTTTGCTTAAAAAGG + Intergenic
1041864583 8:62556201-62556223 AATACCTATTTGGGGAATTATGG + Intronic
1042886420 8:73557499-73557521 GAAACCTAATTAGCAAAATAAGG - Intronic
1044790936 8:95846253-95846275 AAGACTTAGTTGGCTAAAGATGG + Intergenic
1045027781 8:98105212-98105234 ATAAACTATTTATCTAAATAGGG + Intronic
1045346390 8:101297618-101297640 AAAGCCCCTTTTGCTAAATATGG - Intergenic
1047111639 8:121795894-121795916 AAATAATATTTGGCTAACTAAGG - Intergenic
1047147749 8:122223816-122223838 AAAACCTATGTGTCTGAAGATGG - Intergenic
1049149598 8:141026118-141026140 AAAACCCATTTGGTTATATTGGG + Intergenic
1051080417 9:13287495-13287517 AAAAGTTATTTGGGTAAAGATGG - Intergenic
1051799603 9:20917765-20917787 AAAATCTATTTAGCTACAGAAGG - Intronic
1052614079 9:30815743-30815765 AAAAGCACTTTGGCTAGATAAGG + Intergenic
1053638237 9:40037335-40037357 AGAAACTATATGGCTAAATGTGG + Intergenic
1053767848 9:41427885-41427907 AGAAACTATATGGCTAAATGTGG - Intergenic
1054546513 9:66339389-66339411 AGAAACTATATGGCTAAATGTGG - Intergenic
1054714898 9:68547332-68547354 AAAATCTAATTGGCAGAATATGG + Intergenic
1055084024 9:72295800-72295822 ATAACATATTTGGCCATATATGG - Intergenic
1059866994 9:118526097-118526119 AAAACCCTTTTCTCTAAATAAGG - Intergenic
1060623058 9:125084861-125084883 AAAATCTAATAAGCTAAATAAGG + Intronic
1060961100 9:127681332-127681354 AAAACGTTTTTTGCCAAATATGG + Intronic
1202786107 9_KI270719v1_random:20893-20915 AGAAACTATATGGCTAAATGTGG + Intergenic
1203604268 Un_KI270748v1:44947-44969 AAAATCTATTTGGCTCAGAAAGG + Intergenic
1187167416 X:16817303-16817325 AAAAACTCTTTGGCAATATATGG - Intronic
1188454222 X:30344138-30344160 AAAAAATATTTGAATAAATATGG + Intergenic
1191051823 X:56201816-56201838 AAAACCCAGTAGCCTAAATATGG + Intergenic
1194075659 X:89388972-89388994 AAAACATAATTGGTTAAAAAAGG - Intergenic
1194116634 X:89907452-89907474 ACAATCTATATGGCAAAATATGG + Intergenic
1195071658 X:101286974-101286996 GAAACCTATTTCCCTAATTAGGG - Intronic
1195933893 X:110107026-110107048 AAAGGCTGTTTGGCTAAACAAGG - Intronic
1196085272 X:111677596-111677618 AAAACTTCTTTGGCTACATTGGG - Intronic
1196561998 X:117160740-117160762 AAAACCTGAGTGGCTTAATATGG + Intergenic
1198789713 X:140331062-140331084 AAAACTCATTTGGCAGAATAAGG - Intergenic
1199124175 X:144094623-144094645 ATAACCTTTTTGGGTAATTATGG + Intergenic
1200469432 Y:3564624-3564646 ACAATCTATATGGCAAAATATGG + Intergenic
1200731260 Y:6743128-6743150 AAAACATAATTGGTTAAAAAAGG - Intergenic
1200822744 Y:7604567-7604589 AAAACTTATTTTGATAAACATGG + Intergenic
1202099560 Y:21293099-21293121 AAAAACAATTTGGCAACATAGGG + Intergenic
1202237312 Y:22726522-22726544 AAAACTTATTTTGATAAACATGG - Intergenic