ID: 958136926

View in Genome Browser
Species Human (GRCh38)
Location 3:89505914-89505936
Sequence TCATCCTTGAATAAAACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958136923_958136926 24 Left 958136923 3:89505867-89505889 CCACTTATCATTTTTATCTTACA No data
Right 958136926 3:89505914-89505936 TCATCCTTGAATAAAACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958136926 Original CRISPR TCATCCTTGAATAAAACTGC AGG Intergenic
No off target data available for this crispr