ID: 958141435

View in Genome Browser
Species Human (GRCh38)
Location 3:89567514-89567536
Sequence GGTCCCAATGCAACAATAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958141433_958141435 30 Left 958141433 3:89567461-89567483 CCTGAGCACTCAGATATATAAAG No data
Right 958141435 3:89567514-89567536 GGTCCCAATGCAACAATAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958141435 Original CRISPR GGTCCCAATGCAACAATAGC TGG Intergenic
No off target data available for this crispr