ID: 958147791

View in Genome Browser
Species Human (GRCh38)
Location 3:89649220-89649242
Sequence TCAGAACTGAGTTGAACTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958147791_958147795 16 Left 958147791 3:89649220-89649242 CCAATAGTTCAACTCAGTTCTGA No data
Right 958147795 3:89649259-89649281 TAGTGCAGAACCACAGGTTAAGG No data
958147791_958147796 17 Left 958147791 3:89649220-89649242 CCAATAGTTCAACTCAGTTCTGA No data
Right 958147796 3:89649260-89649282 AGTGCAGAACCACAGGTTAAGGG No data
958147791_958147794 10 Left 958147791 3:89649220-89649242 CCAATAGTTCAACTCAGTTCTGA No data
Right 958147794 3:89649253-89649275 TGGAGTTAGTGCAGAACCACAGG No data
958147791_958147792 -10 Left 958147791 3:89649220-89649242 CCAATAGTTCAACTCAGTTCTGA No data
Right 958147792 3:89649233-89649255 TCAGTTCTGACTCTGACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958147791 Original CRISPR TCAGAACTGAGTTGAACTAT TGG (reversed) Intergenic
No off target data available for this crispr