ID: 958147794

View in Genome Browser
Species Human (GRCh38)
Location 3:89649253-89649275
Sequence TGGAGTTAGTGCAGAACCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958147791_958147794 10 Left 958147791 3:89649220-89649242 CCAATAGTTCAACTCAGTTCTGA No data
Right 958147794 3:89649253-89649275 TGGAGTTAGTGCAGAACCACAGG No data
958147790_958147794 22 Left 958147790 3:89649208-89649230 CCAACTGAGTATCCAATAGTTCA No data
Right 958147794 3:89649253-89649275 TGGAGTTAGTGCAGAACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958147794 Original CRISPR TGGAGTTAGTGCAGAACCAC AGG Intergenic
No off target data available for this crispr