ID: 958149943

View in Genome Browser
Species Human (GRCh38)
Location 3:89678577-89678599
Sequence GGTGTAATGAGAGGAACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958149943_958149948 25 Left 958149943 3:89678577-89678599 CCTGGTGTTCCTCTCATTACACC No data
Right 958149948 3:89678625-89678647 CCTTCCCTGTTCAATCCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958149943 Original CRISPR GGTGTAATGAGAGGAACACC AGG (reversed) Intergenic
No off target data available for this crispr