ID: 958151014

View in Genome Browser
Species Human (GRCh38)
Location 3:89695536-89695558
Sequence CTGTGTGTAGGGAGAGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958151014_958151020 5 Left 958151014 3:89695536-89695558 CCTGCCCCTCTCCCTACACACAG No data
Right 958151020 3:89695564-89695586 TGAGAGTGAAGTTCTATCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958151014 Original CRISPR CTGTGTGTAGGGAGAGGGGC AGG (reversed) Intergenic
No off target data available for this crispr