ID: 958158566

View in Genome Browser
Species Human (GRCh38)
Location 3:89787352-89787374
Sequence GGTCCTTATTGACTACCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958158554_958158566 29 Left 958158554 3:89787300-89787322 CCTTTTTTTTTCTCTTTTTCTTT No data
Right 958158566 3:89787352-89787374 GGTCCTTATTGACTACCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958158566 Original CRISPR GGTCCTTATTGACTACCAGG TGG Intergenic
No off target data available for this crispr