ID: 958162107

View in Genome Browser
Species Human (GRCh38)
Location 3:89830830-89830852
Sequence GGAGTGAGAGACTCTCCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958162105_958162107 10 Left 958162105 3:89830797-89830819 CCATGGTTTTGTATAGGACTATT No data
Right 958162107 3:89830830-89830852 GGAGTGAGAGACTCTCCTGTTGG No data
958162101_958162107 29 Left 958162101 3:89830778-89830800 CCTGATGAGCTAGTTACTCCCAT No data
Right 958162107 3:89830830-89830852 GGAGTGAGAGACTCTCCTGTTGG No data
958162104_958162107 11 Left 958162104 3:89830796-89830818 CCCATGGTTTTGTATAGGACTAT No data
Right 958162107 3:89830830-89830852 GGAGTGAGAGACTCTCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958162107 Original CRISPR GGAGTGAGAGACTCTCCTGT TGG Intergenic