ID: 958164570

View in Genome Browser
Species Human (GRCh38)
Location 3:89862995-89863017
Sequence CGGTGCACCCAGAGAGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958164567_958164570 2 Left 958164567 3:89862970-89862992 CCTGCATGTGGAAGTGCTTGAAG No data
Right 958164570 3:89862995-89863017 CGGTGCACCCAGAGAGGACATGG No data
958164566_958164570 3 Left 958164566 3:89862969-89862991 CCCTGCATGTGGAAGTGCTTGAA No data
Right 958164570 3:89862995-89863017 CGGTGCACCCAGAGAGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958164570 Original CRISPR CGGTGCACCCAGAGAGGACA TGG Intergenic
No off target data available for this crispr