ID: 958165938

View in Genome Browser
Species Human (GRCh38)
Location 3:89877610-89877632
Sequence TGGGAGTGACCCCAAGACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958165935_958165938 5 Left 958165935 3:89877582-89877604 CCTTGTGTTCTGGTGATTGCAGT No data
Right 958165938 3:89877610-89877632 TGGGAGTGACCCCAAGACCTAGG No data
958165934_958165938 8 Left 958165934 3:89877579-89877601 CCTCCTTGTGTTCTGGTGATTGC No data
Right 958165938 3:89877610-89877632 TGGGAGTGACCCCAAGACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958165938 Original CRISPR TGGGAGTGACCCCAAGACCT AGG Intergenic
No off target data available for this crispr