ID: 958167828

View in Genome Browser
Species Human (GRCh38)
Location 3:89900113-89900135
Sequence GCCTCCAGTTAGGCTACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958167828_958167833 -8 Left 958167828 3:89900113-89900135 CCCAAAGTAGCCTAACTGGAGGC No data
Right 958167833 3:89900128-89900150 CTGGAGGCACCCCCCAGTAGGGG No data
958167828_958167841 17 Left 958167828 3:89900113-89900135 CCCAAAGTAGCCTAACTGGAGGC No data
Right 958167841 3:89900153-89900175 GAATGACACCTCACACGGCCGGG 0: 15
1: 964
2: 1525
3: 2149
4: 1322
958167828_958167832 -9 Left 958167828 3:89900113-89900135 CCCAAAGTAGCCTAACTGGAGGC No data
Right 958167832 3:89900127-89900149 ACTGGAGGCACCCCCCAGTAGGG No data
958167828_958167840 16 Left 958167828 3:89900113-89900135 CCCAAAGTAGCCTAACTGGAGGC No data
Right 958167840 3:89900152-89900174 AGAATGACACCTCACACGGCCGG 0: 12
1: 822
2: 2243
3: 1242
4: 583
958167828_958167839 12 Left 958167828 3:89900113-89900135 CCCAAAGTAGCCTAACTGGAGGC No data
Right 958167839 3:89900148-89900170 GGGAAGAATGACACCTCACACGG No data
958167828_958167831 -10 Left 958167828 3:89900113-89900135 CCCAAAGTAGCCTAACTGGAGGC No data
Right 958167831 3:89900126-89900148 AACTGGAGGCACCCCCCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958167828 Original CRISPR GCCTCCAGTTAGGCTACTTT GGG (reversed) Intergenic
No off target data available for this crispr