ID: 958172551

View in Genome Browser
Species Human (GRCh38)
Location 3:89956114-89956136
Sequence GTGTCATAAGGCCACCTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958172551_958172556 17 Left 958172551 3:89956114-89956136 CCCATGAGGTGGCCTTATGACAC No data
Right 958172556 3:89956154-89956176 GTTGACTCTTTGACTTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958172551 Original CRISPR GTGTCATAAGGCCACCTCAT GGG (reversed) Intergenic
No off target data available for this crispr