ID: 958179068

View in Genome Browser
Species Human (GRCh38)
Location 3:90034241-90034263
Sequence GTAAACTACTTGGGAAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958179065_958179068 -10 Left 958179065 3:90034228-90034250 CCATACTGTAACTGTAAACTACT No data
Right 958179068 3:90034241-90034263 GTAAACTACTTGGGAAAAAAAGG No data
958179061_958179068 16 Left 958179061 3:90034202-90034224 CCCTTGAGAGATGCAGCTTATGG No data
Right 958179068 3:90034241-90034263 GTAAACTACTTGGGAAAAAAAGG No data
958179060_958179068 27 Left 958179060 3:90034191-90034213 CCTTGAGAGATCCCTTGAGAGAT No data
Right 958179068 3:90034241-90034263 GTAAACTACTTGGGAAAAAAAGG No data
958179063_958179068 15 Left 958179063 3:90034203-90034225 CCTTGAGAGATGCAGCTTATGGG No data
Right 958179068 3:90034241-90034263 GTAAACTACTTGGGAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958179068 Original CRISPR GTAAACTACTTGGGAAAAAA AGG Intergenic
No off target data available for this crispr