ID: 958179879

View in Genome Browser
Species Human (GRCh38)
Location 3:90046512-90046534
Sequence AGTTATCCACAGAGGATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958179875_958179879 4 Left 958179875 3:90046485-90046507 CCAAAAACTGTTTCTCAAAAGGA No data
Right 958179879 3:90046512-90046534 AGTTATCCACAGAGGATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958179879 Original CRISPR AGTTATCCACAGAGGATAGC AGG Intergenic
No off target data available for this crispr