ID: 958205052

View in Genome Browser
Species Human (GRCh38)
Location 3:90380665-90380687
Sequence TTTCTTTTTATGGAGCAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958205052_958205056 30 Left 958205052 3:90380665-90380687 CCAAACTGCTCCATAAAAAGAAA No data
Right 958205056 3:90380718-90380740 CACAAGGAAGTTTCTGAGAATGG No data
958205052_958205055 14 Left 958205052 3:90380665-90380687 CCAAACTGCTCCATAAAAAGAAA No data
Right 958205055 3:90380702-90380724 AGATAAATGCACACATCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958205052 Original CRISPR TTTCTTTTTATGGAGCAGTT TGG (reversed) Intergenic
No off target data available for this crispr