ID: 958205054

View in Genome Browser
Species Human (GRCh38)
Location 3:90380688-90380710
Sequence CATTTATCTCAGATATTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958205054_958205055 -9 Left 958205054 3:90380688-90380710 CCTTTAAATATCTGAGATAAATG No data
Right 958205055 3:90380702-90380724 AGATAAATGCACACATCACAAGG No data
958205054_958205056 7 Left 958205054 3:90380688-90380710 CCTTTAAATATCTGAGATAAATG No data
Right 958205056 3:90380718-90380740 CACAAGGAAGTTTCTGAGAATGG No data
958205054_958205057 17 Left 958205054 3:90380688-90380710 CCTTTAAATATCTGAGATAAATG No data
Right 958205057 3:90380728-90380750 TTTCTGAGAATGGTTCTGTCTGG No data
958205054_958205058 30 Left 958205054 3:90380688-90380710 CCTTTAAATATCTGAGATAAATG No data
Right 958205058 3:90380741-90380763 TTCTGTCTGGTTTTTATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958205054 Original CRISPR CATTTATCTCAGATATTTAA AGG (reversed) Intergenic
No off target data available for this crispr