ID: 958205055

View in Genome Browser
Species Human (GRCh38)
Location 3:90380702-90380724
Sequence AGATAAATGCACACATCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958205052_958205055 14 Left 958205052 3:90380665-90380687 CCAAACTGCTCCATAAAAAGAAA No data
Right 958205055 3:90380702-90380724 AGATAAATGCACACATCACAAGG No data
958205053_958205055 4 Left 958205053 3:90380675-90380697 CCATAAAAAGAAACCTTTAAATA No data
Right 958205055 3:90380702-90380724 AGATAAATGCACACATCACAAGG No data
958205054_958205055 -9 Left 958205054 3:90380688-90380710 CCTTTAAATATCTGAGATAAATG No data
Right 958205055 3:90380702-90380724 AGATAAATGCACACATCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958205055 Original CRISPR AGATAAATGCACACATCACA AGG Intergenic
No off target data available for this crispr