ID: 958205057

View in Genome Browser
Species Human (GRCh38)
Location 3:90380728-90380750
Sequence TTTCTGAGAATGGTTCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958205054_958205057 17 Left 958205054 3:90380688-90380710 CCTTTAAATATCTGAGATAAATG No data
Right 958205057 3:90380728-90380750 TTTCTGAGAATGGTTCTGTCTGG No data
958205053_958205057 30 Left 958205053 3:90380675-90380697 CCATAAAAAGAAACCTTTAAATA No data
Right 958205057 3:90380728-90380750 TTTCTGAGAATGGTTCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958205057 Original CRISPR TTTCTGAGAATGGTTCTGTC TGG Intergenic
No off target data available for this crispr