ID: 958255965

View in Genome Browser
Species Human (GRCh38)
Location 3:91325178-91325200
Sequence GACCTACACACTTTGGGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958255959_958255965 -1 Left 958255959 3:91325156-91325178 CCATATGAACCCTCCTAAAACTG No data
Right 958255965 3:91325178-91325200 GACCTACACACTTTGGGTTCAGG No data
958255957_958255965 14 Left 958255957 3:91325141-91325163 CCATATCCTAAAATTCCATATGA No data
Right 958255965 3:91325178-91325200 GACCTACACACTTTGGGTTCAGG No data
958255958_958255965 8 Left 958255958 3:91325147-91325169 CCTAAAATTCCATATGAACCCTC No data
Right 958255965 3:91325178-91325200 GACCTACACACTTTGGGTTCAGG No data
958255960_958255965 -10 Left 958255960 3:91325165-91325187 CCCTCCTAAAACTGACCTACACA No data
Right 958255965 3:91325178-91325200 GACCTACACACTTTGGGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958255965 Original CRISPR GACCTACACACTTTGGGTTC AGG Intergenic
No off target data available for this crispr