ID: 958268923

View in Genome Browser
Species Human (GRCh38)
Location 3:91473979-91474001
Sequence ATGTTGTTATAATTGGGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958268923_958268927 8 Left 958268923 3:91473979-91474001 CCTTGACCCAATTATAACAACAT No data
Right 958268927 3:91474010-91474032 CCTTAAGCATGCTGTCATCAAGG 0: 3
1: 0
2: 0
3: 6
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958268923 Original CRISPR ATGTTGTTATAATTGGGTCA AGG (reversed) Intergenic
No off target data available for this crispr