ID: 958268923 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:91473979-91474001 |
| Sequence | ATGTTGTTATAATTGGGTCA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 958268923_958268927 | 8 | Left | 958268923 | 3:91473979-91474001 | CCTTGACCCAATTATAACAACAT | No data | ||
| Right | 958268927 | 3:91474010-91474032 | CCTTAAGCATGCTGTCATCAAGG | 0: 3 1: 0 2: 0 3: 6 4: 143 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 958268923 | Original CRISPR | ATGTTGTTATAATTGGGTCA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||