ID: 958270124

View in Genome Browser
Species Human (GRCh38)
Location 3:91489359-91489381
Sequence CCATTAGTCAATAAGGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958270124_958270127 10 Left 958270124 3:91489359-91489381 CCAGGTGCCTTATTGACTAATGG No data
Right 958270127 3:91489392-91489414 GCCTGCTTTGCAGTGTTGATAGG 0: 3
1: 0
2: 0
3: 20
4: 130
958270124_958270129 13 Left 958270124 3:91489359-91489381 CCAGGTGCCTTATTGACTAATGG No data
Right 958270129 3:91489395-91489417 TGCTTTGCAGTGTTGATAGGAGG 0: 3
1: 0
2: 0
3: 16
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958270124 Original CRISPR CCATTAGTCAATAAGGCACC TGG (reversed) Intergenic
No off target data available for this crispr