ID: 958423896

View in Genome Browser
Species Human (GRCh38)
Location 3:93959432-93959454
Sequence TGGCAAGAGAATGCAGCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958423896 Original CRISPR TGGCAAGAGAATGCAGCTTG TGG (reversed) Intronic
900628262 1:3619511-3619533 TGGGAAGAGATTGCATCATGGGG + Intergenic
900887124 1:5423062-5423084 TGGCAACAGGATCCAGTTTGTGG - Intergenic
902235713 1:15056126-15056148 TGGCGAGGGAATGCCGCTTGGGG - Exonic
902596542 1:17513561-17513583 TGGAAACAAAATGCAGGTTGGGG + Intergenic
904405415 1:30285226-30285248 TGGGAAGATAAAGCAGCTTCCGG - Intergenic
905682581 1:39884687-39884709 TGGCCAAAGAATGCAACATGTGG + Intergenic
906722460 1:48018964-48018986 TGGACAGAGACTGGAGCTTGCGG + Intergenic
908466379 1:64400077-64400099 TGGCAAATGAATACAGGTTGTGG + Intergenic
909365300 1:74813619-74813641 TTGTAAGTGAAAGCAGCTTGAGG - Intergenic
910921714 1:92355636-92355658 TAGAAAGAGAAGGCATCTTGGGG - Intronic
911482638 1:98463150-98463172 TGGCAAGAGATTGCTTCTTTTGG + Intergenic
912465741 1:109872437-109872459 TGGCAGGAGAATGCCTCTGGCGG - Intergenic
912551395 1:110487648-110487670 AGGCAGGAGAATGCAGTTAGGGG + Intergenic
914505506 1:148285835-148285857 TGGGAAGAGAATGCATCTCTGGG + Intergenic
914507056 1:148298316-148298338 TGGGAAGAGAATGCATCTCTGGG - Intergenic
914884808 1:151576196-151576218 TGACAAGCGCATGCTGCTTGGGG - Intronic
915844204 1:159246821-159246843 TGGCCAGAGAATACACCTTGTGG - Intergenic
916842296 1:168613101-168613123 TGGCAAATGGATGCTGCTTGTGG + Intergenic
917634112 1:176918577-176918599 TGGCAATAGAGTGGGGCTTGGGG - Intronic
919887114 1:201942579-201942601 TAGCCAGAGTATGCATCTTGGGG + Intronic
919994193 1:202732866-202732888 TGTCAAAAGAATCCAGCTTTTGG + Intronic
920102417 1:203525672-203525694 AGGAAAGAGAATGGGGCTTGGGG + Intergenic
920160591 1:203995136-203995158 TGGCTAGAGAAGGCAGATAGAGG + Intergenic
1065524334 10:26603636-26603658 TGGAAAGAGAATGCAGATAAGGG + Intergenic
1067898451 10:50211905-50211927 TGAGAAGAGAATGCAGAATGTGG + Intronic
1068377767 10:56206984-56207006 TAGCAACAGGATGCAGCTGGAGG - Intergenic
1074354914 10:112774003-112774025 TGGCAAAAGAAGACAGCTAGGGG + Intronic
1074676650 10:115859099-115859121 GGGCAAGAGAGTGGAGCTTCAGG - Intronic
1075911560 10:126129457-126129479 TGGGAAGAGAATCCAGCTCCTGG - Intronic
1077482837 11:2824616-2824638 TGGCAAGAGATTGCAGGGAGAGG + Intronic
1082212877 11:49526620-49526642 TGGCAAGAGACTTCATGTTGTGG + Intergenic
1082225913 11:49706446-49706468 TGTCAAGAGACTGGATCTTGAGG + Intergenic
1085454522 11:76658209-76658231 TAGGAAGAGAATGAAACTTGTGG - Exonic
1087181121 11:95143634-95143656 TGGCAGGAGGATGGAGGTTGTGG + Intergenic
1089654766 11:119939283-119939305 TGGAAAGAGAATGGACTTTGAGG - Intergenic
1091191433 11:133698699-133698721 TGCCACGAGAATGCAGGATGTGG - Intergenic
1094237079 12:28180816-28180838 TCTCAAGAGAGTGCTGCTTGGGG + Intronic
1095360939 12:41337890-41337912 TAGGAAGAGAATGGATCTTGTGG - Intronic
1095421061 12:42024118-42024140 TGTCAGGAGAAGGCAGCTCGGGG - Intergenic
1096622050 12:52871142-52871164 TGGGAATAGACTGCAGCTGGCGG + Intergenic
1098087349 12:66860905-66860927 TGGCAACAGAAAGCAGTTTGTGG + Intergenic
1098887843 12:75978247-75978269 GGGCAAGAGAACGCAGCTCAGGG + Intergenic
1100221447 12:92508457-92508479 TGCCAAGAGAATGGAGCATATGG - Intergenic
1102961590 12:117096970-117096992 TGGCATGAGAATGGAGCTTTAGG - Intronic
1103929937 12:124444722-124444744 TGGGAAGAGACTGCGGGTTGGGG + Intronic
1103950477 12:124548328-124548350 TGGGAAGAGAATGGAGAGTGTGG + Intronic
1104834315 12:131777834-131777856 TGGGAAGAGAGTGCTGCCTGTGG + Intronic
1107768493 13:43763617-43763639 TGGGAAGTGAATGAGGCTTGAGG - Intronic
1110200943 13:72850102-72850124 TTGCTAAAGAATGCAGGTTGTGG + Intronic
1111703419 13:91718693-91718715 GGGCAAGAGTATGCAGATGGGGG - Intronic
1113013631 13:105800569-105800591 TGGCAAGATAAAGCACCTTCAGG + Intergenic
1113195200 13:107795872-107795894 AGGCAAGAGAATGGTGTTTGGGG - Intronic
1113526314 13:110980713-110980735 TGGACAGAGAGTGCAGCATGGGG - Intergenic
1114209441 14:20602689-20602711 TGGCAAGAGTTGGCAGCGTGCGG + Intronic
1115402219 14:32974772-32974794 TGTAAAGAGAAGTCAGCTTGGGG - Intronic
1117521529 14:56556427-56556449 TTGCCAGAAAATGTAGCTTGTGG - Intronic
1118083035 14:62383669-62383691 TGGCAAGAGATGGCTGCTTTTGG + Intergenic
1119651199 14:76384700-76384722 TGTCATGAGAATGCAGCCAGAGG - Intronic
1120182089 14:81354133-81354155 TGGCCAGGGAATGCACCCTGTGG + Intronic
1124067411 15:26357859-26357881 TGGATAGAGAATGTAGCTTTGGG + Intergenic
1124551141 15:30682462-30682484 TGGCAAGGGATTGAAGCTTTTGG - Intronic
1125542845 15:40480582-40480604 TGGCTGGAGGATACAGCTTGAGG + Intergenic
1127144161 15:56007512-56007534 TGGCAAGAGCATCCAGACTGGGG - Intergenic
1127918362 15:63473838-63473860 TGTTAATAGAATGCAGATTGCGG + Intergenic
1129624957 15:77187514-77187536 TGGAAATTGAATCCAGCTTGAGG - Intronic
1129651977 15:77497396-77497418 TTGCCTGAGAATGCAGCTTCTGG + Intergenic
1130971955 15:88740609-88740631 TGGACAGAGAATTCAGCCTGCGG + Intergenic
1132212913 15:100038060-100038082 ATGCAAGAGAATGCAGTTGGAGG - Intronic
1133220560 16:4317517-4317539 TGGCACCAGAATGGGGCTTGGGG - Intronic
1134368083 16:13597768-13597790 TGGCAAGAAAATCGAGCGTGTGG - Intergenic
1135302328 16:21341261-21341283 TGGCAAGAATATGGAGCATGAGG - Intergenic
1135993601 16:27232142-27232164 TGGCCAGAGGCTGCTGCTTGTGG - Intronic
1136556772 16:31011519-31011541 TGGCAAGAGAATGCCGGGTGCGG - Intergenic
1139073198 16:63409092-63409114 TGGAAAGTGGATGCAGCATGTGG - Intergenic
1139252157 16:65506710-65506732 TGGCAGTAGAAGGCACCTTGAGG - Intergenic
1139485634 16:67255217-67255239 TGGTCAGAGCATGCAGCCTGGGG - Intronic
1141046246 16:80718620-80718642 TGGAAAAAGAATGCAGCTGAAGG + Intronic
1141646026 16:85368235-85368257 TGGAGAGAGAATGAAGCTTCTGG - Intergenic
1143986332 17:10917769-10917791 TGGCAAGGAAATGTAGTTTGGGG - Intergenic
1144694226 17:17290729-17290751 TGGCAAGCGACTACAGCTTCAGG + Intergenic
1148341267 17:46874955-46874977 GGACAAGAGAATGTGGCTTGAGG - Intronic
1150584060 17:66501649-66501671 TGGCCCTAGAATGCAGCTTGGGG + Intronic
1150592838 17:66578394-66578416 TGGAAGGGGAATGCAGCATGAGG + Intronic
1151189965 17:72391170-72391192 TGGGAAGTGATTGCATCTTGGGG - Intergenic
1151820927 17:76496423-76496445 TGGCAAGAGGCTGCAGAGTGTGG - Intronic
1154389558 18:13924642-13924664 AGGAAAGAGAAAGCACCTTGTGG - Intergenic
1155863099 18:30929147-30929169 AGGCAAGACAGTGCAGCATGAGG + Intergenic
1155932105 18:31719013-31719035 TGGAACGAGCATGCAGCTTCAGG - Intergenic
1156416602 18:36899906-36899928 TTGCAAGAAAATCCAGCTTGTGG + Intronic
1158565097 18:58548218-58548240 TGGCGAGAAAATGCAGGTTTGGG + Intronic
1160262252 18:77305458-77305480 TTGCACTAGAAGGCAGCTTGAGG - Intergenic
1161065243 19:2234278-2234300 TGGCAAGAGGAAGCTGCTTGTGG - Intronic
1162198995 19:9007769-9007791 TGGGAAGAGACTGAAGGTTGAGG - Intergenic
1164394769 19:27852845-27852867 GGGCAAGTCAAAGCAGCTTGGGG + Intergenic
1164573346 19:29389922-29389944 TTGCTAGAGAGTGCAGCTTTTGG - Intergenic
1166369707 19:42294013-42294035 TGGCCAGAGACTGCAGGGTGGGG - Exonic
1167136361 19:47618582-47618604 TGGCAAGGGAATGAAGGTAGCGG - Intronic
924986332 2:273428-273450 TGGCAGGAGTCTGCAGATTGGGG + Intronic
925888343 2:8412514-8412536 TGAGAAGAGAATGGACCTTGAGG + Intergenic
927358513 2:22204239-22204261 AGGCAAGAGAAAGAAGATTGTGG + Intergenic
928682261 2:33714549-33714571 TGGCAAGGGAATGTATTTTGGGG + Intergenic
930893083 2:56413425-56413447 AAGCAAGAGATTGCAGCTGGGGG + Intergenic
930895383 2:56440194-56440216 TGGGGAGAGACTGCTGCTTGAGG - Intergenic
931212495 2:60211153-60211175 TGGCAATAGATTTCATCTTGAGG + Intergenic
931487507 2:62707203-62707225 TTGGAAGAGACTGCAGCGTGTGG + Exonic
933944633 2:87275392-87275414 TGGCAAGAGAATCCAGGATGTGG + Intergenic
933967514 2:87442127-87442149 TGGGGAGAGGATGCAGCTGGAGG + Intergenic
935703979 2:105840075-105840097 TGGCAAGAGGAGACAGCTTCTGG + Intronic
936326281 2:111508369-111508391 TGGGGAGAGGATGCAGCTGGAGG - Intergenic
936335579 2:111586186-111586208 TGGCAAGAGAATCCAGGATGTGG - Intergenic
939722140 2:145667161-145667183 TGCCAAGAGGAGACAGCTTGTGG + Intergenic
939810401 2:146824814-146824836 TGGCAAGAAAATGAGGCTTCTGG - Intergenic
940721995 2:157292539-157292561 TGGGAAGTGAATGCAGGTTTGGG + Intronic
940951730 2:159682815-159682837 TTGCAAGAGAATGCAGTGTTTGG - Intergenic
942875380 2:180789629-180789651 TGGCAAGAGAAGGTAGACTGGGG - Intergenic
943960640 2:194258030-194258052 TGGGAAATGAAGGCAGCTTGGGG + Intergenic
945035130 2:205697862-205697884 TGGAAAGGGAATGCCCCTTGAGG - Intronic
948292239 2:236834418-236834440 TGGTAAGTGCATGCTGCTTGAGG - Intergenic
1168904132 20:1390617-1390639 TGGGAACAGAATCCATCTTGGGG - Intronic
1169927626 20:10799375-10799397 TTGCAAATGAATCCAGCTTGTGG + Intergenic
1170710870 20:18789593-18789615 GGTCCAGAGAAAGCAGCTTGGGG + Intergenic
1174641301 20:52046758-52046780 TGTGAAGATAATCCAGCTTGGGG - Intergenic
1176037514 20:63047037-63047059 TGGGAAGAAAATGCAGGCTGTGG + Intergenic
1176687582 21:9864737-9864759 TTGCCTGAGAATGCAGCTAGGGG + Intergenic
1179518467 21:41926193-41926215 TGTCAAAAAAATGCAGGTTGGGG - Intronic
1184297689 22:43535575-43535597 TGGCAGGAGAATGCGGCATGAGG - Intronic
1184484311 22:44766848-44766870 TGGCAGCAGAATGCAGCCTGAGG + Intronic
949738454 3:7201513-7201535 TGGCAACAGACTTCAACTTGTGG - Intronic
951702148 3:25507519-25507541 TGGGAAGAGGAAGCAGCTTATGG - Intronic
952634387 3:35509198-35509220 TGACAAGAGAATGCAGTTAATGG + Intergenic
953947022 3:47158104-47158126 TGGCAATCTAATGAAGCTTGTGG + Intronic
954196790 3:49001822-49001844 TGGCAGGAGAATCCACCTGGGGG + Intronic
955579246 3:60401310-60401332 AGGAAAGAGAATGCATCTGGTGG - Intronic
958423896 3:93959432-93959454 TGGCAAGAGAATGCAGCTTGTGG - Intronic
962434954 3:135357645-135357667 TGGCAAGATAATTCATCTTAAGG - Intergenic
965943931 3:174217238-174217260 TAGCATGACAATGCAGCATGTGG - Intronic
967365557 3:188682556-188682578 TGGCAAGTGAATGGGGTTTGAGG + Intronic
967874304 3:194256313-194256335 TTGGAGGAAAATGCAGCTTGAGG - Intergenic
969528959 4:7719365-7719387 TGGCAAGAGGACGCCACTTGAGG - Intronic
969968322 4:11020173-11020195 TGGGAAGAGAATTAAGCCTGAGG + Intergenic
970700675 4:18734298-18734320 AGGAGAGAGAATGCAGTTTGAGG + Intergenic
971255971 4:25013599-25013621 TGGCAAGACAATTGAGCCTGAGG + Intronic
973257878 4:48131025-48131047 GGGCAAGGGAAAGCAGCTGGGGG - Intronic
980350929 4:131682553-131682575 TTGCCTGAGAATGCAGCTAGGGG + Intergenic
980918266 4:139055036-139055058 TAGCAAGAGAATGAGGCTTGGGG + Intronic
982236824 4:153258970-153258992 TGGTATGAGAAAGCAGCTTTCGG + Intronic
982246906 4:153362300-153362322 TGGCAAGTGATTGGATCTTGGGG + Intronic
982622778 4:157727827-157727849 TGGGAAGAGACTCCTGCTTGAGG + Intergenic
984495992 4:180497751-180497773 TGGGGAGAGAATTCAGTTTGGGG - Intergenic
985808634 5:2067204-2067226 AGACAACAGAATGCAACTTGAGG + Intergenic
986610002 5:9557706-9557728 TGGAAAGAGAATGGAGTTTGGGG - Intergenic
988117839 5:26919981-26920003 TGGGAAGAGAATCCTGCTTGAGG + Intronic
988340992 5:29971393-29971415 TAGCAAGAGAATGCAATTAGAGG + Intergenic
990388826 5:55297615-55297637 TGGCAAGAAAAAGCCTCTTGAGG + Intronic
990513409 5:56510138-56510160 TGGCAATAGCAGGCAGTTTGTGG + Intergenic
992326947 5:75669196-75669218 TGGAAAGAGATAGCAGCTCGTGG + Intronic
993533722 5:89055162-89055184 TGCCAAGAAAATGCCGCTTTGGG + Intergenic
993794859 5:92254512-92254534 TGGTATGAGACGGCAGCTTGTGG - Intergenic
995599515 5:113780344-113780366 TGGCAAATTAATGGAGCTTGAGG + Intergenic
999171649 5:149600434-149600456 GGGCCAGAGAATGCATCTTGAGG + Intronic
1001635742 5:173208884-173208906 TGAGAAGAGAATTCAGCTAGCGG - Intergenic
1004511003 6:16284717-16284739 TTGTAAGAAAATGCAGCTAGTGG + Intronic
1004544892 6:16588318-16588340 TTGGAAGAGAATGCAGGTTTTGG - Intronic
1005037413 6:21569607-21569629 TGGAAAGAGACTCCTGCTTGAGG - Intergenic
1010896503 6:81371428-81371450 TGGTTAGACAATGAAGCTTGAGG + Intergenic
1011790217 6:90890873-90890895 TGGAAAGAGGAGGCAGCCTGGGG - Intergenic
1012226893 6:96714960-96714982 TAGCAAAAAAATGCAGTTTGAGG + Intergenic
1012764920 6:103355738-103355760 TGGCAAGCCACTGCACCTTGAGG - Intergenic
1013765363 6:113567837-113567859 AGGCAAGAGGATTCTGCTTGAGG - Intergenic
1017770481 6:157640338-157640360 TGTCCAGTGAATGCAACTTGGGG - Intronic
1018258260 6:161943888-161943910 TGGCCTGAGGATGCAGCCTGAGG + Intronic
1018882458 6:167898342-167898364 TGGCATGAAAGTGCAGTTTGGGG + Exonic
1018951663 6:168382266-168382288 AGGCAAGCGTATGCAGCTGGGGG - Intergenic
1019315359 7:381648-381670 TAGCAAGAGAAGGCAGCTGGGGG + Intergenic
1020497449 7:8874050-8874072 TGGTAAGGGAATGCAGATTATGG + Intergenic
1020578436 7:9963941-9963963 TGGGAAGAGAATGCAGGGCGGGG - Intergenic
1021757908 7:23873225-23873247 TGGCAAGAAATTGGAGCTTCTGG + Intergenic
1022755975 7:33290268-33290290 TGCCATGTGAATGCAGCATGGGG + Intronic
1023205902 7:37749528-37749550 TGGAAACAGAATGCAGCTTTGGG - Intronic
1023735637 7:43233924-43233946 TGGAAATAGATTGCAGCTTCTGG + Intronic
1024354853 7:48403892-48403914 TGGGAAGAGAAGGCAGAATGAGG - Intronic
1026238179 7:68547448-68547470 CGGCAAGAAAATGCCGCTTTTGG - Intergenic
1026626599 7:71998274-71998296 TGGGAAGAGAATCAAGCTTGGGG + Intronic
1030058211 7:105601694-105601716 TTGGAAGGGAATGCAGCCTGCGG + Intergenic
1031303319 7:120091222-120091244 TGGTAAGAGAAAGCAGCTTGAGG - Intergenic
1032710403 7:134455973-134455995 TGAGAAGAGAATGGAGTTTGAGG + Intronic
1034270246 7:149800188-149800210 TGCCAAGAGGAGGGAGCTTGGGG + Intergenic
1035486756 7:159232088-159232110 TGGCAAGAACACGCAGATTGCGG + Intergenic
1037530256 8:19766048-19766070 CTGCAAGAGAGTGCAGCTGGTGG - Intergenic
1038067099 8:23974649-23974671 TGGCAAGAGGTTGCAGTTTCTGG + Intergenic
1040046189 8:42966324-42966346 GTGCTTGAGAATGCAGCTTGTGG + Intronic
1040576918 8:48660572-48660594 AGGCAAGTGAATGCAACGTGGGG - Intergenic
1040767970 8:50938658-50938680 AGGCAAGAGAAGAGAGCTTGTGG - Intergenic
1041525985 8:58806372-58806394 TGTGAAAAGCATGCAGCTTGAGG + Exonic
1042667827 8:71225773-71225795 TGGCAATAAGATGCAACTTGTGG + Intronic
1045287966 8:100808169-100808191 TAGCAAGAGAGTGCACCCTGAGG - Intergenic
1046788264 8:118291768-118291790 GGGCAACAGGAAGCAGCTTGTGG - Intronic
1047919566 8:129620225-129620247 TGGAAAGAGGATGCATTTTGGGG - Intergenic
1049050815 8:140193727-140193749 TGGGAAGAGCATGCACTTTGAGG + Intronic
1051801863 9:20943845-20943867 TGGTAAGATAATGCAGCTTGTGG - Intronic
1053217188 9:36281841-36281863 TCGAAAGTGAATGCATCTTGAGG + Intronic
1053781774 9:41617162-41617184 TTGCCTGAGAATGCAGCTAGGGG - Intergenic
1054169724 9:61827316-61827338 TTGCCTGAGAATGCAGCTAGGGG - Intergenic
1054667814 9:67753499-67753521 TTGCCTGAGAATGCAGCTAGGGG + Intergenic
1055172448 9:73275566-73275588 TTGCAACAGAATGAACCTTGAGG - Intergenic
1055271436 9:74563971-74563993 TGGCAAGAGAATGCAGCTGTAGG + Intronic
1055570730 9:77614452-77614474 TGGCAAAATTATGCAGCATGGGG - Intronic
1057905632 9:98980880-98980902 TGGCAAGAATATGCTGCTGGTGG + Intronic
1057908842 9:99002923-99002945 TGGAAAGAGAGAGCAGCTTTGGG - Intronic
1058679157 9:107426129-107426151 TAGCAAGAGAAGGCTGTTTGGGG + Intergenic
1060195446 9:121620661-121620683 AGGCAAGAGAGGGCAGCTGGAGG - Intronic
1060730723 9:126035136-126035158 TGGCAAGATAAAGCTGCTTGTGG + Intergenic
1061759387 9:132839698-132839720 TGTGAACAGAATGCAGATTGAGG + Intronic
1061764989 9:132875959-132875981 TATCAAGAGAAAGCAGCTTCTGG + Intronic
1061788901 9:133048167-133048189 TGACAAGAGTATGCTGCTTGTGG - Intronic
1062324474 9:136005541-136005563 TGGCAAGGGGATGGCGCTTGAGG - Intergenic
1187283267 X:17879106-17879128 TGGCAAGAGAATGTACTTGGTGG - Intergenic
1189690505 X:43612828-43612850 TGGGAAGGGACTGCATCTTGTGG - Intergenic
1189984711 X:46544004-46544026 TGGCAAGAGAAGGAAGCATGGGG + Intronic
1191111291 X:56804685-56804707 AAGCAATAGAATTCAGCTTGAGG - Intergenic
1192174070 X:68874949-68874971 CGGCAAAAGAATGCAGCCAGGGG - Intergenic
1198630424 X:138631143-138631165 TTGCCAGACAATGCAGCTTTGGG + Intergenic
1198894675 X:141439846-141439868 TGGCAAGAGAAAGTTGCTTCTGG + Intergenic
1199661608 X:150055747-150055769 TGGGAAGAGAAGTCAGTTTGGGG - Intergenic
1200100049 X:153685790-153685812 TGCTCAGAGAATGCAGTTTGGGG + Intronic