ID: 958428385

View in Genome Browser
Species Human (GRCh38)
Location 3:94007075-94007097
Sequence GTTTAGGCTCAGATAAGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958428385_958428390 23 Left 958428385 3:94007075-94007097 CCGCGCCTTATCTGAGCCTAAAC 0: 1
1: 0
2: 1
3: 4
4: 55
Right 958428390 3:94007121-94007143 TTAGAAGTCATTTTAATGCTTGG 0: 1
1: 0
2: 0
3: 35
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958428385 Original CRISPR GTTTAGGCTCAGATAAGGCG CGG (reversed) Intronic
902532027 1:17096707-17096729 GTTTAGTATCAGACAAGGTGGGG + Intronic
905025302 1:34845596-34845618 GTCGAGGCTCTGATAAGGCAGGG + Intronic
919851876 1:201678463-201678485 GTTGAGGCACAGAGAAGGCAAGG + Intronic
1067186312 10:44030862-44030884 GTTTAAGCTCTGATAGGGCCTGG - Intergenic
1067477719 10:46577823-46577845 GCTTTGGCTCACCTAAGGCGAGG - Intergenic
1067617019 10:47763961-47763983 GCTTTGGCTCACCTAAGGCGAGG + Intergenic
1085045304 11:73349254-73349276 CTTGAGGCTCAGAGAAGGTGAGG - Intronic
1091050280 11:132362061-132362083 GTTGAGTTTCAGATAAGGTGGGG + Intergenic
1091619801 12:2078093-2078115 GATTAGGTTCAGATGAGGCCAGG + Intronic
1095463694 12:42468228-42468250 GTTTATGCTCAGAAAAGGTATGG - Intronic
1100745754 12:97643975-97643997 GTGTAGTCACAGATAAGGTGAGG - Intergenic
1101489007 12:105194837-105194859 CTGTATGTTCAGATAAGGCGTGG + Intronic
1102348798 12:112176811-112176833 CTTAGGGCTCAGATAGGGCGGGG + Intronic
1110686930 13:78386485-78386507 GTATAGGCTCAGAAAAGGAAGGG + Intergenic
1110709793 13:78637815-78637837 GTTTGGGCTCAGAAAAGGCCAGG - Intronic
1114769824 14:25416254-25416276 CTTATGGCTCAGATAAGGTGGGG - Intergenic
1122528517 14:102407554-102407576 GTTTATGCTCAGAGAAAGCCGGG + Intronic
1124178865 15:27454339-27454361 GTAAATGCTTAGATAAGGCGTGG - Intronic
1125766247 15:42138442-42138464 GCCTGGGCTCAGAGAAGGCGGGG + Intergenic
1132129672 15:99264366-99264388 GTTAAGGCTCAGCAAAAGCGGGG + Intronic
1134134713 16:11670807-11670829 GATCAGGCTCAGACAAGCCGGGG + Intronic
1134507983 16:14823546-14823568 GTTTGGGGTCAGATAAGCCTGGG - Intronic
1134695685 16:16222309-16222331 GTTTGGGGTCAGATAAGCCTGGG - Intronic
1134976143 16:18572377-18572399 GTTTGGGGTCAGATAAGCCTGGG + Intergenic
1139769723 16:69264237-69264259 GTTTAGCCCCAGCTAAGCCGAGG + Intronic
1141674945 16:85512952-85512974 GTTTAGGGTCAGATAAAGTGTGG - Intergenic
1143978858 17:10850510-10850532 GTCTAGGCTGAGATAAGGAAAGG + Intergenic
1147839802 17:43363318-43363340 GTTTAGGCTCAGGTTAAGTGCGG - Intergenic
1149559158 17:57595863-57595885 GTTGAGGCTCAGAGAGGGCAAGG + Intronic
1161815783 19:6499032-6499054 GTGTGGGCTCAGACCAGGCGCGG + Intronic
1162802104 19:13116914-13116936 GTTGTGGCTCAGAAAAGGGGCGG + Exonic
1164237699 19:23351438-23351460 GTTAAGGCTCTGATAAATCGGGG + Intronic
1166558554 19:43717284-43717306 GCTGAGGCTCAGACAGGGCGAGG + Intronic
927026764 2:19076182-19076204 GCTGAGGCTCAGAAAAGGCAGGG - Intergenic
927958157 2:27222939-27222961 GATTAGGCTCAGATAAAACACGG - Exonic
928489932 2:31771775-31771797 TTTTTGCCTCAGATAAGGCCAGG + Intergenic
939820334 2:146949291-146949313 GTTTAATCTGAGATAAGGAGTGG - Intergenic
943263372 2:185695055-185695077 GTTTAGGATCAGCAAAGGCCTGG + Intergenic
946723649 2:222639231-222639253 GTTTTGGTTCAGATCAGTCGTGG - Intronic
1168875000 20:1165221-1165243 GTCTTGGCTCTGATAAGGGGTGG - Exonic
1168961129 20:1870717-1870739 GTTGAGGCTCAGAGAAAGCAAGG - Intergenic
1169589307 20:7122476-7122498 GCTGAGGCTCAGATCAGGTGAGG + Intergenic
1169667035 20:8049356-8049378 GTTTAGGCTCAGTTGAGGCCTGG + Intergenic
1183321537 22:37167806-37167828 CTTTAGGCTCAGAGAAGCTGTGG - Intronic
958428385 3:94007075-94007097 GTTTAGGCTCAGATAAGGCGCGG - Intronic
961415226 3:126752159-126752181 GTTTGGGCTTAGAAAAGGTGGGG + Intronic
980618825 4:135270284-135270306 GTTAAGGCTCAGAGAAAGCCTGG + Intergenic
983907620 4:173200658-173200680 GTTTAGGGTCTGCTAAGGAGTGG + Intronic
985165263 4:187087376-187087398 TTTTAGGTTCAGATAAGTAGAGG - Intergenic
985708124 5:1413487-1413509 GTTGAGGCTCAGTGAAGGCGGGG - Intronic
997824608 5:137095427-137095449 GTTTGGGCTCAGCTAAGTCTAGG + Intronic
998715005 5:144873090-144873112 GTTTAGAATCAGATAAAGAGAGG + Intergenic
1000176782 5:158763863-158763885 GCTGAGGCTCAGATAAGGGAAGG - Intronic
1005054663 6:21718220-21718242 GTTTGGGTTAAGATAAGGGGTGG + Intergenic
1014995258 6:128135184-128135206 ATTTAGTCTTAGATAAGGCAAGG + Intronic
1021090288 7:16474847-16474869 GTGTAGGCTGAGTTAAGACGAGG + Intronic
1031053034 7:116964609-116964631 GTTCAGGCTCAGAGTTGGCGTGG + Intronic
1038158806 8:25016998-25017020 ATTGAGGCTCAGAGAAGGCCAGG - Intergenic
1048500388 8:134969995-134970017 GTATAGTCGCAGATAAAGCGTGG + Intergenic
1195211864 X:102657584-102657606 GTTTAGATTCGGATAAGGTGGGG - Exonic
1198444296 X:136696194-136696216 GTTTAGGCTCAGATCAGGCAAGG + Intronic