ID: 958431137

View in Genome Browser
Species Human (GRCh38)
Location 3:94043138-94043160
Sequence GGCCAAAAAAATAATGAATT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 529
Summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 485}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958431136_958431137 -7 Left 958431136 3:94043122-94043144 CCAGGTTAATCACAATGGCCAAA 0: 1
1: 0
2: 2
3: 10
4: 126
Right 958431137 3:94043138-94043160 GGCCAAAAAAATAATGAATTTGG 0: 1
1: 0
2: 0
3: 43
4: 485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958431137 Original CRISPR GGCCAAAAAAATAATGAATT TGG Exonic
900704885 1:4074171-4074193 GGCAATAAAAATAATTTATTGGG + Intergenic
901281896 1:8043926-8043948 GGGCAAGAAAATGATGAAGTTGG - Intergenic
901379107 1:8861119-8861141 GGCGAGAAAAACAATGACTTGGG + Exonic
903386031 1:22927279-22927301 TGCTCAGAAAATAATGAATTAGG - Intergenic
903853795 1:26323773-26323795 GGCCAAACAAAAAATTAACTGGG - Intronic
904109859 1:28117368-28117390 GGCCAAAAGAATACAGACTTTGG + Intergenic
905052490 1:35063685-35063707 GCCCAAAAAGATAAGGAAATAGG + Intronic
906079625 1:43076215-43076237 AGCCATAAAAAGAATGAAATTGG - Intergenic
908268394 1:62400106-62400128 CTCCAAAAAAATAATAAAATAGG + Intergenic
908920686 1:69187844-69187866 AGACAGAAAAAAAATGAATTGGG + Intergenic
908960232 1:69688681-69688703 GGCCAATAAAATGATAAAATAGG - Intronic
909544859 1:76834905-76834927 GTTCAAAAGAATACTGAATTTGG + Intergenic
910991346 1:93059663-93059685 GGACAAATACATAATGAATGTGG - Intergenic
911018180 1:93357629-93357651 GGAAAAAAAATTACTGAATTTGG - Intronic
911132524 1:94404143-94404165 GGACAAAAAAATTATGGAGTAGG - Intergenic
911355002 1:96806056-96806078 GAAGAAAAAAATAAGGAATTGGG - Intronic
912052746 1:105550422-105550444 AGACAAAAAAAAAATTAATTTGG - Intergenic
912233471 1:107822352-107822374 GGAAAAAAAAATAATTAAATGGG + Intronic
913493836 1:119408755-119408777 AGCCAACAAAATACTGAATGGGG + Intergenic
915566204 1:156714484-156714506 CGAAAAAAAAAAAATGAATTTGG - Intergenic
915867737 1:159522612-159522634 AGCCAACATAATACTGAATTGGG - Intergenic
916376748 1:164163258-164163280 GGACAAAAAAAAAAAGAATAAGG - Intergenic
916753377 1:167744014-167744036 AGCCAACATAATAATGAATAGGG - Intronic
916879815 1:169009337-169009359 GAGTAAAAAAATAATGAATCAGG + Intergenic
918255674 1:182744426-182744448 GTCTTAAAAAACAATGAATTGGG - Intergenic
918619589 1:186587496-186587518 GACTAAAAAAATAATATATTTGG - Intergenic
918880796 1:190118029-190118051 GCCCAAAAACATAATGCATTTGG - Intronic
919236788 1:194856230-194856252 AGCCAAAAAATTAACAAATTGGG - Intergenic
919305514 1:195829830-195829852 GGGAAAGAAAATAATGGATTTGG + Intergenic
919623828 1:199891514-199891536 GGGAAAAAAGATAATGAAATTGG + Intergenic
919920964 1:202166214-202166236 GGCCTCAAAGATAATGAACTTGG - Intergenic
920003494 1:202815457-202815479 GGGGAAAAAAAAAAAGAATTAGG - Intergenic
920650332 1:207832783-207832805 TTCCAAAAAAATAATGTGTTTGG + Intergenic
920815198 1:209324859-209324881 GGCCATAATAAAGATGAATTAGG + Intergenic
920904290 1:210146393-210146415 GGTCACAAATAAAATGAATTAGG + Intronic
921258789 1:213366783-213366805 AGCCAAAAATATCATGAACTTGG - Intergenic
921599909 1:217095651-217095673 TGGTAAGAAAATAATGAATTTGG + Intronic
921739769 1:218670282-218670304 GGCCAAAAAGGTAAGGAATCGGG - Intergenic
921759667 1:218898336-218898358 GGCCAAATAAAATATCAATTTGG + Intergenic
1063003790 10:1949387-1949409 AGCAAAAAAAATAATAAATTGGG - Intergenic
1063236384 10:4120841-4120863 TGCCAAAAAAAAAATTATTTGGG - Intergenic
1063322426 10:5062968-5062990 AGAGAAAAAAATAATGAATCAGG - Intronic
1063575987 10:7262372-7262394 GGCCCAAAAAATAAAAAATCAGG + Intronic
1063699228 10:8368684-8368706 GGAGAAAAAAATAAAAAATTAGG - Intergenic
1064393907 10:14964777-14964799 GGAAAAAAAAAAAATGAACTGGG - Intronic
1064609274 10:17080327-17080349 GGTCTAAAATATGATGAATTAGG + Intronic
1066506629 10:36051771-36051793 GGTCAAACAAATCATGTATTGGG + Intergenic
1066531916 10:36350350-36350372 GACGAATAAACTAATGAATTAGG - Intergenic
1067677448 10:48396081-48396103 GGAGAAAAAAATAATGACTTGGG + Intronic
1068045117 10:51876749-51876771 TGCCAAGAAATTAATGAATCTGG + Intronic
1068173121 10:53421984-53422006 GGCCAAAAAAACTATGACCTAGG - Intergenic
1068304614 10:55190892-55190914 TCAAAAAAAAATAATGAATTTGG - Intronic
1069089776 10:64185952-64185974 GGCCAAAAAAAAAAAAAATCTGG + Intergenic
1069222395 10:65901024-65901046 GGCTAAAGAAAAAATGAAATAGG + Intergenic
1070041173 10:72781817-72781839 GGCCAAAGGAATAATGATCTTGG + Intronic
1070558692 10:77549579-77549601 GGCCAAAAAAATGAGGACTCTGG + Intronic
1071139815 10:82495415-82495437 GGACAAAAAAAAAATCAAGTAGG - Intronic
1071581977 10:86780075-86780097 GGCCAAAAAACAAATGAAATAGG - Intronic
1071701524 10:87943695-87943717 GGCAAAAATGTTAATGAATTAGG + Intronic
1071837637 10:89435264-89435286 TGCCTGAAAAATAATGAATATGG - Intronic
1071948458 10:90675277-90675299 AGAAAAAAAAATAATGAGTTTGG - Intergenic
1072772723 10:98155119-98155141 GGCCAAAAAAACAACCAAATTGG - Intronic
1073613054 10:104963736-104963758 GGCTTTAAAAATAAAGAATTTGG - Intronic
1074158400 10:110817491-110817513 GGTCAATAAAAGAATGAAATTGG - Intronic
1074258583 10:111828948-111828970 AGCAAAAAAGATAATGTATTTGG - Intergenic
1075267175 10:121011254-121011276 GGCCAAAAAAGTAATTAAAAAGG + Intergenic
1075633307 10:124014358-124014380 GGTTAGAAAAATAATGAAATGGG - Intronic
1075947130 10:126444056-126444078 AGCCAACAAAATACTGAATGGGG + Intronic
1078706963 11:13753365-13753387 GGCCAACATAATACTGAATGGGG + Intergenic
1078875860 11:15395880-15395902 GCCATAAAAAATAATGAAATTGG - Intergenic
1079086492 11:17449306-17449328 AGCCATAAAAATGATGAAGTGGG + Intronic
1081411959 11:42769962-42769984 GGGAAAAAAAATAACAAATTTGG - Intergenic
1081446927 11:43139755-43139777 GGCCAAATAAAGACTGGATTTGG - Intergenic
1082610093 11:55285038-55285060 GTTTAAGAAAATAATGAATTTGG - Intergenic
1083245025 11:61420244-61420266 TTCCAAAAAAATAAAGATTTAGG - Intronic
1083528294 11:63393532-63393554 GGCCAACATAATACTGAATGGGG - Intronic
1084432382 11:69118364-69118386 CCCCAAAAAAATAAGTAATTAGG - Intergenic
1084655534 11:70514508-70514530 GGCAAAAATAATACTGATTTTGG + Intronic
1085213147 11:74801316-74801338 GTCCACAAAAACAATGTATTTGG - Intronic
1085949789 11:81316473-81316495 AACCTAAAAAATAATCAATTTGG - Intergenic
1086239626 11:84673714-84673736 TGATAAAAAATTAATGAATTAGG + Intronic
1086247472 11:84770950-84770972 AGCCATAAAAAGAATGAAATCGG - Intronic
1086450119 11:86907102-86907124 GACCAAAAAAATCATTAATTGGG - Intronic
1086942718 11:92815118-92815140 GAGAAAAGAAATAATGAATTTGG + Intronic
1087783029 11:102321061-102321083 GTCCAAGAAAAAAATGGATTTGG + Intronic
1088035422 11:105306555-105306577 GGCTAAAAAAAGCATAAATTTGG + Intergenic
1088929002 11:114330144-114330166 AGTCAAAAAGATAATCAATTAGG - Intergenic
1089343659 11:117776621-117776643 GGCCAAAAAAAAAAAGTCTTTGG - Intronic
1089993920 11:122886746-122886768 AGCCAAAAAAAGAATTAAGTGGG - Intronic
1090112106 11:123923816-123923838 TGCAAAAAAAATGATGAATCTGG - Intergenic
1090841456 11:130491840-130491862 GACAAAAAAATTAATGAAATGGG - Intergenic
1090893630 11:130949850-130949872 TTCTAAAAAAATAATGAATCTGG - Intergenic
1091728392 12:2861816-2861838 ACACTAAAAAATAATGAATTAGG + Intronic
1092290040 12:7154789-7154811 GGACAAAAAGAAAATGAATGAGG + Intronic
1092626208 12:10332080-10332102 TGCCAAAAAAATAATAAGGTTGG + Intergenic
1092732160 12:11545049-11545071 CACCAAAGTAATAATGAATTGGG - Intergenic
1092858618 12:12699040-12699062 GGGAAAAGAAAGAATGAATTTGG + Intergenic
1093218558 12:16391269-16391291 GGACAAATAAATAATGTATGTGG - Intronic
1093534257 12:20203532-20203554 GCATAAAAAATTAATGAATTGGG - Intergenic
1093647782 12:21608371-21608393 AGCCAAAAGCATAATGAATGAGG + Intergenic
1094583128 12:31752634-31752656 GGCCAAAAAAGCAATCATTTGGG + Intergenic
1094629267 12:32157101-32157123 GGCTTAAAAAATAATAAAATTGG + Intronic
1095228228 12:39702126-39702148 CTTCAAAAAATTAATGAATTTGG + Intronic
1095548453 12:43401948-43401970 GGTAAAGAAAATAATGAGTTAGG - Intronic
1095549562 12:43417711-43417733 GTCCTAAAAAATAATGTTTTGGG - Intronic
1095762284 12:45853110-45853132 GGCCTAGAAAATTATTAATTTGG - Intronic
1097841713 12:64327998-64328020 TGCCAAAAAAAAAATGGCTTAGG - Intronic
1098332207 12:69365065-69365087 TGCCAAAAAAAAAGTTAATTTGG + Intronic
1098446003 12:70566134-70566156 GGACTAGAAAATAATAAATTTGG + Intronic
1098620837 12:72595935-72595957 GGCTAAAAAATTAGTGAATCAGG + Intronic
1098624676 12:72649344-72649366 TGCAAAAGAAATAATGAAATTGG + Intronic
1099516789 12:83606595-83606617 AGCCAACAAAATACTGAATGGGG + Intergenic
1099777100 12:87147746-87147768 GGCCAACATAATACTGAATGGGG - Intergenic
1100052532 12:90466832-90466854 GTCCACAAAAACAATGAGTTTGG + Intergenic
1100245824 12:92755941-92755963 GTACAAAAAAAAAATCAATTAGG + Intronic
1101315486 12:103625104-103625126 GGCTAAATAAATATTGAAATGGG + Intronic
1101553221 12:105782947-105782969 TGCCTAAAAAATAAGGGATTTGG - Intergenic
1103383275 12:120511909-120511931 AGCATAAAAAATAATGATTTTGG + Intronic
1103480925 12:121249200-121249222 AGCCCAAAAAATCATGGATTGGG - Intronic
1104351782 12:128050274-128050296 GCCCAAGGAAATAATGGATTTGG + Intergenic
1104460723 12:128953693-128953715 GGCCAAAGAAGGAAGGAATTTGG - Intronic
1105733118 13:23239618-23239640 AGCCAAAAGAACAATGTATTTGG + Intronic
1105814330 13:24020740-24020762 GGGCATAAAAATAAATAATTTGG + Intronic
1105832247 13:24173507-24173529 GGCCAAAAAAAAAAAAAAGTTGG - Intronic
1106158395 13:27178591-27178613 AGACAATAAAATAATGAATATGG + Intergenic
1106431193 13:29682100-29682122 GGGAAAAAAAATCAAGAATTGGG + Intergenic
1106638629 13:31559106-31559128 GGCTAAAAAATTAATGAATAAGG + Intergenic
1106865960 13:33964440-33964462 GGACAAAAACAGAATGATTTGGG - Intronic
1107120019 13:36786092-36786114 TGCCAAAAAAACAGTGAATTTGG + Intergenic
1108413956 13:50178659-50178681 GACCAAAGAAAAGATGAATTTGG + Intronic
1109176258 13:59160638-59160660 ATCCAAAAAAATAAGCAATTTGG + Intergenic
1109179275 13:59193838-59193860 GGCAAAAAAAAAAATGAAATTGG - Intergenic
1109571068 13:64191114-64191136 GGCCAAATTAATAATTAAATAGG - Intergenic
1109658706 13:65429747-65429769 GAAAACAAAAATAATGAATTAGG - Intergenic
1110696101 13:78492286-78492308 GGCAAACATATTAATGAATTTGG - Intergenic
1110904808 13:80873479-80873501 ACACACAAAAATAATGAATTTGG + Intergenic
1111003343 13:82214920-82214942 AGTCAAAAAAATAAGGAATCTGG - Intergenic
1111026156 13:82528255-82528277 GGCAAAATAAATAATGACTATGG - Intergenic
1111224199 13:85248100-85248122 GAGGAAAAAAAAAATGAATTTGG + Intergenic
1112843670 13:103611142-103611164 AGCCATAAAAACAATGAATAAGG - Intergenic
1112908855 13:104457195-104457217 AGCCAAAAAAATACTGTATGTGG + Intergenic
1114860636 14:26516368-26516390 GGGAAAAAAAACAATAAATTGGG - Intronic
1115162957 14:30416408-30416430 GACCAAAAAAATAACTAGTTTGG + Intergenic
1115613450 14:35070722-35070744 GGCCAAAAATATAATCATTTAGG - Intronic
1115617613 14:35111424-35111446 GGCCAAGATATTAATAAATTTGG + Intronic
1115784959 14:36815201-36815223 GGACAAATAACTAATGAATGTGG + Intronic
1115896310 14:38092216-38092238 GGGAAGAAAAAAAATGAATTAGG + Intergenic
1115930970 14:38494109-38494131 GGCCATAAAAAGAATAAATTCGG - Intergenic
1117046452 14:51817715-51817737 GGATTAAAAAATAAAGAATTTGG + Intergenic
1117224693 14:53643258-53643280 GACAAAAAAGATTATGAATTAGG - Intergenic
1117280219 14:54233535-54233557 GCCCAAAAAAATAATAAAGATGG + Intergenic
1117933929 14:60880157-60880179 AGCCAATAAAAATATGAATTGGG + Intronic
1118023024 14:61738649-61738671 GGACAAAAACATCTTGAATTTGG + Intronic
1118431589 14:65724261-65724283 GGACAAAAAAAGAGTGTATTTGG + Exonic
1118647839 14:67857404-67857426 GTACATAAAAATAATGAAGTAGG + Intronic
1119358102 14:74024039-74024061 GGTCATAAAAATAATTAAATAGG - Intronic
1119953057 14:78765793-78765815 AGCCAAAGAAATAATGGATGGGG - Intronic
1119991983 14:79208395-79208417 GGCCAAGAAAATAAAAAATTGGG - Intronic
1120412865 14:84179147-84179169 GGCAATAAAAAAAATCAATTAGG + Intergenic
1120831502 14:89001292-89001314 GGCCCCAAACATCATGAATTAGG - Intergenic
1121754228 14:96390029-96390051 TCTCAAAAAAATAATAAATTTGG + Intergenic
1125050939 15:35297485-35297507 GGGGAAAAAAATAAAGAATTAGG - Intronic
1125105851 15:35969834-35969856 GGCTAAGAAAATAATAAATGTGG + Intergenic
1125417783 15:39471297-39471319 GACCAGAAAAAAAATTAATTAGG + Intergenic
1125716480 15:41822563-41822585 GGTCAGAGAAATCATGAATTGGG - Intronic
1126669923 15:51106611-51106633 TGAAAAAAAAATAATCAATTTGG - Intergenic
1127843515 15:62849803-62849825 GGCCAAAAAAGCAGGGAATTTGG - Intergenic
1128352843 15:66902873-66902895 GGCAAAAATAAAAATGCATTAGG + Intergenic
1131100851 15:89689012-89689034 GGTTAAAAAAATAATCATTTAGG - Intronic
1131755514 15:95556873-95556895 GGACAAAAAAATATTTGATTTGG - Intergenic
1133688198 16:8187309-8187331 GGCAAAAAACAAAATAAATTGGG - Intergenic
1134144745 16:11751351-11751373 GGCCCAAATGATAATGACTTTGG - Exonic
1134876916 16:17708738-17708760 GGCCAAATAACTAATGCATGTGG - Intergenic
1135316666 16:21452499-21452521 GGCAAAAAAAATATTAAAATTGG - Intergenic
1135442225 16:22486383-22486405 GGCAAAAAAAATATTAAAATTGG + Intronic
1137331165 16:47498233-47498255 TGCCAAAAAGATAATAAAATGGG - Intronic
1138707489 16:58931889-58931911 AGTAAAAAAAAAAATGAATTGGG + Intergenic
1139311433 16:66031463-66031485 GGCAAAAAAAAAAAAAAATTGGG + Intergenic
1144435339 17:15234805-15234827 GGAAAAAAAAAAAAAGAATTTGG - Intronic
1144458591 17:15439181-15439203 GACCAAAGAAATATAGAATTAGG - Intronic
1146714553 17:35073839-35073861 GGCTAAATAAATAAAGCATTAGG - Intronic
1147517049 17:41128882-41128904 GGCCAACATAATACTGAATGGGG + Intergenic
1147810698 17:43167799-43167821 GGCAAAATAAATCATGAATGAGG - Intergenic
1148567929 17:48644799-48644821 GGCCAGAAAAAAAAAGAAGTTGG + Intergenic
1150190051 17:63229036-63229058 GGCCAATATCATAATGAATGGGG - Intronic
1150842825 17:68625127-68625149 GGACAAAAAAATAAAGCATTTGG - Intergenic
1203166445 17_GL000205v2_random:101331-101353 AGCCTAAAAAATAATGAAATTGG + Intergenic
1153265456 18:3264401-3264423 GGCAATAAAAAGAATGAATATGG + Intronic
1155060231 18:22222191-22222213 AGCCAAAAGAATAATGAAGCTGG + Intergenic
1155457937 18:26040981-26041003 GGCTAAAAAAATTGAGAATTAGG - Intronic
1155751950 18:29435449-29435471 GGCCAAAAAGCAAATCAATTTGG + Intergenic
1156212514 18:34960702-34960724 GACCAAAAAAATCATAAATTAGG - Intergenic
1156651450 18:39231466-39231488 GGCCACAAAAAAAATCAATGAGG - Intergenic
1156895150 18:42237516-42237538 AGCCAAAAAAATAATGAGGGAGG - Intergenic
1156976396 18:43226564-43226586 GGCCAACATAATACTGAATGGGG + Intergenic
1158002948 18:52640243-52640265 AGCCAACATAATACTGAATTGGG + Intronic
1158723562 18:59947709-59947731 GGCCAAAAAAAAAAAAAAATAGG - Intergenic
1158942387 18:62417237-62417259 GGCCAAAAAAATCATAAAGAAGG - Intergenic
1159116903 18:64124909-64124931 GAGCAAAAAGATATTGAATTTGG - Intergenic
1159270491 18:66142910-66142932 GTCTAATAAAATAATGACTTTGG + Intergenic
1161387882 19:4006565-4006587 GGCCAAAAAAAAAATTAGCTGGG + Intergenic
1161831420 19:6607417-6607439 ACCCAAAAAACTAATAAATTGGG - Intergenic
1162174599 19:8821960-8821982 GGCCAAAGGAATAATGATTTGGG + Intronic
1164663631 19:30004594-30004616 GGCCATAAAAATTCTGTATTTGG + Intronic
1167355887 19:49003771-49003793 GGAAAAAAAAAAAAAGAATTGGG + Intronic
1167822771 19:51944190-51944212 TGCCATAAACATAATGCATTTGG + Exonic
1168401299 19:56087522-56087544 GCAGAAAAAAATAATGGATTGGG + Exonic
1168490664 19:56806054-56806076 GGTTATAAAAATAATGTATTAGG + Intronic
925695619 2:6574962-6574984 TGACATAAAAATAATTAATTGGG - Intergenic
925697899 2:6601715-6601737 GGATAAAAAGATATTGAATTAGG - Intergenic
925850059 2:8071925-8071947 GGCAAAAACAATTATGCATTGGG - Intergenic
926558625 2:14390362-14390384 GAACAAAAAAAAAATGAATTTGG + Intergenic
926736010 2:16073816-16073838 GGCCAACAAAAGAATGGTTTAGG - Intergenic
926744606 2:16140555-16140577 AACCAAAAGAATAATTAATTTGG - Intergenic
926897356 2:17708322-17708344 GGGCAAATAAAAAATAAATTTGG + Intronic
928439274 2:31278245-31278267 GGCCAAAAAAAAGCTGGATTAGG - Intergenic
928571990 2:32618852-32618874 AGCCAAATAAATAAAGACTTAGG + Exonic
928607724 2:32959174-32959196 GGCCAAAGGAAAGATGAATTTGG + Intronic
928676455 2:33655954-33655976 GGCTTAAAAAAAAATGAACTGGG + Intergenic
929844168 2:45504367-45504389 TGCAAAAAACATAAAGAATTTGG - Intronic
930649643 2:53951916-53951938 GCCCAAAATAATAATATATTTGG - Intronic
930928534 2:56851500-56851522 GGTAAAAAAAAAAATGAACTTGG + Intergenic
931136687 2:59410602-59410624 GGCCAACATAATACTGAATGAGG - Intergenic
931221141 2:60289094-60289116 GGCCGAAAAAAAAATGGAATTGG + Intergenic
932016223 2:68029912-68029934 AGCCATAAAAATAATAAATCTGG + Intergenic
932087733 2:68776603-68776625 GGCCAAAAAAGCAATGAGGTTGG - Intronic
932927404 2:75993236-75993258 GGCCAAATACCTAATGCATTTGG + Intergenic
933321969 2:80787649-80787671 GGTCAAAAGAATAAGGAATAAGG - Intergenic
933329561 2:80878237-80878259 TGCCAAACAAATCATGAACTGGG + Intergenic
933438937 2:82285106-82285128 GCCTAAAAAAAAAATGCATTGGG - Intergenic
934562844 2:95322062-95322084 GGCCATAAGAATAATGAGGTTGG + Intronic
934873333 2:97888540-97888562 GGACTAAACAAAAATGAATTTGG + Intronic
935093708 2:99923101-99923123 AGCTTAAAACATAATGAATTTGG - Intronic
935099898 2:99983635-99983657 GGCAAAAAACATAATGATCTGGG + Intronic
935865013 2:107377883-107377905 GGCCATGAAAAAGATGAATTAGG + Intergenic
936245607 2:110824304-110824326 AGCCAAAACAATATTGAAGTAGG - Intronic
936558295 2:113514815-113514837 GGCCAAATAAAGACTGGATTTGG + Intergenic
936946682 2:117937362-117937384 GGCCATAAAACTACTCAATTTGG + Intronic
937123369 2:119456375-119456397 GTCCAGCAAAATAATGAATTAGG + Intronic
937757079 2:125552640-125552662 GGTCTAAAAAATTATGAATATGG - Intergenic
937806785 2:126154304-126154326 GGCCACAGAAATAATAAAATAGG - Intergenic
938187949 2:129249893-129249915 TGCCAAAAACCTAATGAACTTGG - Intergenic
938593248 2:132760956-132760978 GGACACAAAAAGAGTGAATTAGG + Intronic
938682902 2:133710495-133710517 TGACATAAAAATAATGAATTTGG - Intergenic
938922026 2:136003829-136003851 GGGAAAGAAAGTAATGAATTTGG - Intergenic
940170414 2:150824089-150824111 GGAAAGAAAAAAAATGAATTAGG + Intergenic
940549056 2:155128461-155128483 GGAGAAAAAAACAATGAATAGGG + Intergenic
941230124 2:162901647-162901669 AGCCAAAATAATATTGAATGGGG - Intergenic
941314887 2:163980082-163980104 GGCCACGAAAATGATGAAGTAGG + Intergenic
941417141 2:165234656-165234678 AGCCAAAAAAAAACTGCATTTGG - Intergenic
941702445 2:168618265-168618287 AGCCAAAATAATACTGAATGGGG + Intronic
942005059 2:171689860-171689882 GGCAAGAAAAATAAAAAATTAGG - Intronic
942174287 2:173316604-173316626 GTACAAAAAAATAAAGAGTTTGG - Intergenic
942288824 2:174449542-174449564 AGCCATAAAAAGAATGAAATAGG + Intronic
942846574 2:180433190-180433212 GGCAAAAAAAATTATTAATTGGG + Intergenic
943109043 2:183583122-183583144 GGACAAATAACTAATGCATTTGG - Intergenic
943192008 2:184689482-184689504 TGCCTAAAAATTAAGGAATTTGG + Intronic
943412971 2:187564249-187564271 TGCCAAACAAATCATGAACTGGG + Intronic
943435338 2:187858819-187858841 GGCCTAAAATATATTGACTTGGG + Intergenic
943672638 2:190679964-190679986 GGCCAGAACACTGATGAATTCGG - Intronic
943890970 2:193286653-193286675 AGCCAAAATAATACTGAATGAGG - Intergenic
944992312 2:205252385-205252407 TGTCAAACAAATACTGAATTAGG - Intronic
945595812 2:211790034-211790056 GTCATAAAAAATAATGAACTGGG - Intronic
946886456 2:224227227-224227249 TGCCAAAGGAATCATGAATTGGG - Intergenic
946967909 2:225057735-225057757 TACCAATAAAATAATGAGTTAGG + Intergenic
947202534 2:227627426-227627448 GAACAAAATAATCATGAATTTGG - Intronic
1169519540 20:6356354-6356376 GGCCAAAAAAAGAATGGATCTGG - Intergenic
1172672712 20:36645364-36645386 CTCAAAAAAAAAAATGAATTTGG + Intronic
1172757780 20:37299240-37299262 TACAAAAAAAATAATAAATTAGG - Intronic
1173210910 20:41030489-41030511 GTTCAAAAACATAAAGAATTGGG - Intronic
1173337599 20:42125404-42125426 GGCCAATAAAGTCATGAATCTGG - Intronic
1174470129 20:50752328-50752350 TGCCAAAAAAAAAAAAAATTGGG + Exonic
1174929530 20:54797668-54797690 AGAAGAAAAAATAATGAATTTGG - Intergenic
1176335079 21:5589217-5589239 AGGCTAAAAAATAATGAAATTGG - Intergenic
1176392678 21:6231731-6231753 AGGCTAAAAAATAATGAAATTGG + Intergenic
1176405310 21:6357765-6357787 AGCCTAAAAAATAATGAAATTGG - Intergenic
1176431847 21:6631338-6631360 AGCCTAAAAAATAATGAAATTGG + Intergenic
1176468741 21:7084443-7084465 AGGCTAAAAAATAATGAAATTGG - Intronic
1176492302 21:7466221-7466243 AGGCTAAAAAATAATGAAATTGG - Intergenic
1176508340 21:7672162-7672184 AGGCTAAAAAATAATGAAATTGG + Intergenic
1177014759 21:15772726-15772748 GTCCAGAAAAAGAATAAATTGGG + Intronic
1177119521 21:17123402-17123424 GGCCAAACGAATTATGAACTGGG - Intergenic
1177301565 21:19252083-19252105 AGCCAACAAAATACTGAATGGGG + Intergenic
1177516805 21:22162789-22162811 AGCCAAAATAATAGTAAATTTGG - Intergenic
1182055587 22:27352084-27352106 GTCCAATAAGATAATGAATATGG - Intergenic
1182161435 22:28126103-28126125 GGACTAAAAGAGAATGAATTTGG + Intronic
1182172127 22:28241853-28241875 GGGAAATAAAATAAGGAATTAGG + Intronic
1182851194 22:33475762-33475784 TGTGAAAAAAATAATGAGTTAGG - Intronic
1183668739 22:39259732-39259754 GGCCAAGAATATAATGACATGGG - Intergenic
1185264764 22:49895130-49895152 GCCCTATAAAATAATGAAGTGGG - Intergenic
1185386355 22:50532875-50532897 CGCAAAAAAAATCATGTATTGGG + Intergenic
950824123 3:15798013-15798035 GGAGAAAAAAATAGTGCATTTGG + Intronic
951035444 3:17927303-17927325 TGCCAAAAGAATCAGGAATTTGG + Intronic
952653339 3:35752812-35752834 GTGAAATAAAATAATGAATTTGG - Intronic
953620601 3:44529348-44529370 GGCCAGAAATATAAGGGATTTGG - Intergenic
953731459 3:45453104-45453126 GGCCAATAAAATAAAAAACTTGG - Intronic
953834300 3:46329772-46329794 GGCCATCAAAATATTGAATAAGG + Intergenic
953944106 3:47130807-47130829 TGTCAAAAAAATAGTGAAGTGGG + Intronic
954193482 3:48981500-48981522 GGCCAAATAGAGGATGAATTGGG - Intronic
955898668 3:63727788-63727810 GGGCACAAATTTAATGAATTGGG - Intergenic
957417557 3:79926203-79926225 GACCAAAAAAATGCAGAATTGGG - Intergenic
958431137 3:94043138-94043160 GGCCAAAAAAATAATGAATTTGG + Exonic
958480468 3:94639818-94639840 AGCCAAAATAATACTGAATGGGG - Intergenic
958513063 3:95073899-95073921 CGAGAAAAAAATAATGAAGTTGG + Intergenic
958953648 3:100443222-100443244 AGCCAAGAAAATACAGAATTCGG + Intronic
959207177 3:103324336-103324358 GGCCAACAAAACAAGCAATTAGG - Intergenic
960346902 3:116544442-116544464 AGCCATAAAAATAATGAGGTCGG + Intronic
960757503 3:121032248-121032270 GGCAAAAAAAAAAAAGAAATTGG + Intronic
960980341 3:123218262-123218284 AACCAAAAATATAATGAAATTGG + Intronic
961838609 3:129686879-129686901 TGCCAAGAAAATAGAGAATTTGG + Intronic
962443125 3:135441099-135441121 GGCCTAAAAAATATTCTATTAGG + Intergenic
962504564 3:136032983-136033005 AGCCAACATAATACTGAATTGGG - Intronic
963384842 3:144579038-144579060 AGCCAAAAAAAGAATGGATAGGG + Intergenic
963955400 3:151247771-151247793 AAGCAAAAAAAAAATGAATTAGG + Intronic
964470086 3:157043349-157043371 GGCAAAAAATATAATGGATTGGG + Intronic
964478236 3:157116381-157116403 GGGCAAAATAATAAGGATTTAGG + Intergenic
964773184 3:160246094-160246116 GGCCAAAAAAAAAAAGATGTTGG + Intronic
965216537 3:165871271-165871293 AGCCAAAAAAGTACTGAATGGGG - Intergenic
965378382 3:167955982-167956004 AGCCAACAAAATACTGAATGGGG - Intergenic
965887515 3:173465482-173465504 TGTCAGAAAAATAATAAATTTGG + Intronic
965944249 3:174220544-174220566 TTCAAAAATAATAATGAATTGGG + Intronic
965992622 3:174838377-174838399 GGCCAACATAATACTGAATGGGG + Intronic
968344283 3:197987568-197987590 AGCCAGAAAAAAAATGACTTAGG + Intronic
968499591 4:942046-942068 AGAAAAAAAAAGAATGAATTCGG - Intronic
968986086 4:3875163-3875185 GGCCAAATAAATAAATAAATGGG - Intergenic
971075433 4:23143008-23143030 GATCAAGAAAATAATGGATTAGG - Intergenic
972519489 4:39840259-39840281 TGCCAAAAAATTAAGAAATTGGG + Intronic
973044130 4:45513732-45513754 AGCCAACATAATAATGAATGTGG - Intergenic
974213949 4:58820014-58820036 GGACAAAGAAATAATAAATCAGG + Intergenic
974317455 4:60300397-60300419 GCATGAAAAAATAATGAATTTGG + Intergenic
974689665 4:65280318-65280340 GGCCAATAAAAGAATGACCTCGG - Intergenic
974717599 4:65690017-65690039 GCCTATAAAAATAATGAATTTGG + Intergenic
974776286 4:66486833-66486855 GGCTAAGAAAAAAATTAATTAGG + Intergenic
975790166 4:77940652-77940674 AGCCAACAAAATACTGAATGGGG - Intronic
976591439 4:86853177-86853199 AGTTAAAAAAATACTGAATTTGG - Intergenic
976683500 4:87784954-87784976 GGTCAAAAAAATAATGGAGGAGG - Intergenic
977246352 4:94636414-94636436 GGCAAAAAAAAAAAAAAATTGGG + Intronic
977684640 4:99834632-99834654 GACCAAAAAAAGAAGGAAATTGG + Intronic
978547045 4:109881061-109881083 TGACAAAAAAATAAAGAAATAGG + Intergenic
978789137 4:112642699-112642721 GGAGAAAAAAGTAGTGAATTTGG - Intronic
978831713 4:113093963-113093985 GGCCAAGTTAATTATGAATTTGG - Intronic
979404044 4:120287107-120287129 ACCCAAAAAAAAAATGAATTGGG - Intergenic
979976811 4:127207239-127207261 GGACAAATACATAATGATTTTGG - Intergenic
980284379 4:130763202-130763224 GGACAAATAACTAATGAATGTGG + Intergenic
980593298 4:134920497-134920519 GGCCAAGAAAATAATCATATTGG + Intergenic
980759335 4:137208689-137208711 GTCCAAAAAATTAAAGTATTAGG - Intergenic
981676051 4:147343759-147343781 GGAGAAACAAATAATTAATTTGG - Intergenic
982075618 4:151733982-151734004 AGCCAACATAATAATGAATGGGG + Intronic
982500609 4:156150525-156150547 GCAAAAAAATATAATGAATTGGG + Intergenic
982555593 4:156859347-156859369 GGCAAGAAAAATACTAAATTTGG + Intronic
982822154 4:159954649-159954671 GAACAAAAAAATCAAGAATTAGG - Intergenic
982850193 4:160305111-160305133 AGCCAAAAAAAAAATGACTGTGG - Intergenic
983613067 4:169671479-169671501 GGACAAATACATAATGCATTTGG + Intronic
983673260 4:170262754-170262776 GTCTAAAAAACGAATGAATTGGG - Intergenic
984051848 4:174874093-174874115 GGCAAAAAAAAAAATGATTCTGG - Intronic
984107646 4:175569666-175569688 GTACAAACAAACAATGAATTAGG + Intergenic
984277979 4:177633490-177633512 GGCCAAAAAGGTAATCATTTGGG - Intergenic
984486020 4:180371124-180371146 GAACAAAAACATGATGAATTTGG + Intergenic
984496231 4:180500596-180500618 GGCAATAAAGATGATGAATTTGG + Intergenic
984550474 4:181153287-181153309 GGCCCAATCAACAATGAATTTGG - Intergenic
986352173 5:6890813-6890835 GGAAAAAAAAGTGATGAATTTGG - Intergenic
987502012 5:18723854-18723876 GGACAAAAAAATAATGTTCTAGG + Intergenic
990770637 5:59240410-59240432 GTGCAAATAAATAATAAATTTGG - Intronic
990828959 5:59934899-59934921 GTACAAAAAAATATTGAAGTTGG + Intronic
991329440 5:65477759-65477781 GGCCAAAAAAAAAAAAAATGTGG - Intronic
991445115 5:66691460-66691482 GGCTACATAAAAAATGAATTTGG + Intronic
992276253 5:75122818-75122840 GGCCAATATCATATTGAATTGGG + Intronic
992323352 5:75636165-75636187 TGCAAAACAAATAATGTATTGGG + Intronic
992520663 5:77547155-77547177 AGCCAAAATAATACTGAATGGGG + Intronic
994451229 5:99947080-99947102 GTTCAAAAAAATAAGTAATTTGG - Intergenic
994808749 5:104485980-104486002 AGCCAAACAAATAATTATTTTGG + Intergenic
995336075 5:111001358-111001380 AGCCAAGAAAATAATAAATTAGG + Intergenic
996270644 5:121600747-121600769 GGGCAAAAAAATCATAAAATGGG - Intergenic
996315764 5:122159015-122159037 GGACCAAAAAATATTTAATTTGG + Intronic
996905028 5:128589530-128589552 GAACAAAAGAATAATGATTTTGG - Intronic
998533192 5:142904095-142904117 GGCCCAAACAATCATGACTTAGG + Intronic
1001371354 5:171206690-171206712 GGCCAAAAATATAACTAATAGGG + Intronic
1001418287 5:171564570-171564592 GGCCAAAATAAGAATAAAATTGG - Intergenic
1002387881 5:178882921-178882943 AGCCATAAAAATGTTGAATTTGG + Exonic
1002462712 5:179383592-179383614 GGCTGAAAAAAGAATGGATTTGG - Intergenic
1003247550 6:4397139-4397161 AGCCTAAAAAATACTGATTTGGG - Intergenic
1004156519 6:13173166-13173188 TGCCAAAGAACTAATGTATTTGG + Intronic
1004754620 6:18598359-18598381 TGCCAAATAAAAAATGAACTAGG + Intergenic
1005095358 6:22109043-22109065 AGCAAAAAAAATAATGATTTTGG - Intergenic
1005603632 6:27453008-27453030 GGCCCTGTAAATAATGAATTTGG - Exonic
1005790090 6:29291004-29291026 GGCCAAAAATATATAGAGTTGGG - Intergenic
1005798625 6:29394851-29394873 GTTAAAAAAAATAATGAACTAGG - Intronic
1006978917 6:38130419-38130441 AGCCAACAAAATACTGAATGGGG - Intronic
1007052947 6:38851505-38851527 GACTAAAAAAATAATAATTTAGG + Intronic
1007332068 6:41119881-41119903 GGTTAAAAAAATAAAGAAATTGG - Intergenic
1007778364 6:44236888-44236910 GGCCAAAAAAAAAAAAACTTTGG - Intergenic
1008399493 6:51048303-51048325 GCCCACAAATATAATGAATTTGG - Intergenic
1008508593 6:52255324-52255346 GGAGAAAAAAAAAATGAATATGG + Intergenic
1008831150 6:55764271-55764293 AGCCATAAAAAGAATGAAATTGG + Intronic
1009376126 6:62971892-62971914 TGTCAATAAAATATTGAATTAGG - Intergenic
1009835299 6:68992866-68992888 GGCCAGAGAAATAGTGAAATAGG - Intronic
1009849887 6:69182067-69182089 GGCCAAAAAAATCATTTATTTGG + Intronic
1010251082 6:73707853-73707875 TGCCAAAAAAAGAAAAAATTGGG - Intronic
1010259336 6:73797168-73797190 GACCAACAAAATAATGGGTTAGG - Intronic
1010658848 6:78545005-78545027 AGGAAAAAAGATAATGAATTTGG + Intergenic
1011287734 6:85743219-85743241 GGCCAACACAATACTGAATGGGG - Intergenic
1011308857 6:85959049-85959071 GCCATAAAAAATAATGAAATAGG - Intergenic
1011729225 6:90243677-90243699 GGCCAAAAATTCTATGAATTTGG + Intronic
1012781939 6:103571610-103571632 GTACAAAAAAATAATAAAATAGG - Intergenic
1013020077 6:106206034-106206056 CGACAAAAAAATACTCAATTTGG + Intronic
1013372804 6:109484490-109484512 GGGCAGAAAAATAAGTAATTAGG - Intergenic
1014217099 6:118762747-118762769 AGCCATAAAAAGAATGAAATTGG - Intergenic
1014614854 6:123586920-123586942 GGGCACAGAAATAATGGATTGGG + Intronic
1015780799 6:136863526-136863548 GGCCACAACAGTCATGAATTTGG - Intronic
1015874046 6:137804610-137804632 GGCAGGAAAAATAATGAGTTTGG + Intergenic
1016544898 6:145210241-145210263 TGTGAATAAAATAATGAATTTGG - Intergenic
1017342238 6:153337339-153337361 GTCCACAAAAATAAGGAATGGGG - Intergenic
1018122309 6:160647254-160647276 GGAGCAAAAAACAATGAATTAGG + Intronic
1019115793 6:169761162-169761184 GGCATAAAAATGAATGAATTAGG - Intronic
1020533380 7:9363338-9363360 GCCCAAAATAAAAATGAATGTGG + Intergenic
1020544169 7:9502314-9502336 TTCCAAAAAAAAAATGTATTTGG - Intergenic
1020634490 7:10680057-10680079 GGCCAGAAAAAAAATTATTTGGG - Intergenic
1021630407 7:22639469-22639491 GGATAAAATGATAATGAATTTGG - Intergenic
1022594725 7:31702199-31702221 GGCAAAAAAAAAAATAAATAAGG - Intronic
1023748598 7:43347631-43347653 AGCCAACAAAATACTGAATGGGG - Intronic
1024439360 7:49398180-49398202 GGCCCATAAAATGATGAACTTGG + Intergenic
1024521836 7:50311960-50311982 TACCAAAAAAATAATGACCTGGG + Intronic
1026210770 7:68302541-68302563 GCACAAAAAAATATTTAATTTGG + Intergenic
1026427050 7:70305452-70305474 GTTCATAAAAATATTGAATTTGG + Intronic
1026506194 7:70986417-70986439 GGCCAAATAAAAAATGACTTAGG - Intergenic
1027502886 7:78977128-78977150 AGCCAACAAAATAATGAAGAAGG + Intronic
1027741203 7:82008173-82008195 GGCATAAAAAATAAAGAATAAGG - Intronic
1027969679 7:85062775-85062797 GGCCTCAAAAATAATTTATTTGG - Intronic
1028167836 7:87559422-87559444 GAACAAAAAAAGAATGAATAGGG - Intronic
1028289939 7:89052755-89052777 TGCCTGAAAAAGAATGAATTGGG - Intronic
1028499367 7:91501700-91501722 AGCCAAAAAAATACTGAATGGGG - Intergenic
1028528177 7:91808696-91808718 AGTGAAAAAAATAAGGAATTTGG - Intronic
1028683707 7:93568869-93568891 GGAAAAAAAAATAATGTCTTTGG - Intronic
1028934851 7:96453465-96453487 GGAAAAAAAAAAAAAGAATTTGG + Intergenic
1030686155 7:112488895-112488917 AACCAAAATAATAATGGATTTGG - Intronic
1030740330 7:113101762-113101784 GGCCACAAAATAAATGAATTAGG + Intergenic
1030776990 7:113546235-113546257 GGACTAGAAAATAATGGATTTGG - Intergenic
1030802493 7:113869258-113869280 AATCAAACAAATAATGAATTTGG - Intergenic
1031024496 7:116665257-116665279 TACCAAAAAAAAAATTAATTTGG + Intergenic
1031136232 7:117887283-117887305 GGCCCTCAAAATAATTAATTTGG - Intergenic
1031388851 7:121188262-121188284 GAATAAAAAAATAATAAATTTGG - Intronic
1031700894 7:124924996-124925018 AGCCAACATAATACTGAATTGGG + Intronic
1032034240 7:128509873-128509895 GGCCAAAAATATAATGTAAAAGG - Intergenic
1033064554 7:138141750-138141772 AACCAAAAAAAGAATGAAATAGG - Intergenic
1036518262 8:9466624-9466646 AACCTAAAAAATAATGTATTTGG + Intergenic
1037124581 8:15331652-15331674 GTGCAAAAAAATAATAATTTAGG + Intergenic
1037473608 8:19235950-19235972 GGCCATAGCAAAAATGAATTTGG + Intergenic
1037588072 8:20291832-20291854 GGCAAAAAAAACCATGATTTTGG - Intronic
1039094435 8:33868245-33868267 GGCAGAAAAAACAATGAACTAGG + Intergenic
1039505560 8:38049864-38049886 AGGCAAAAAGATAATAAATTAGG - Intronic
1039658630 8:39437878-39437900 GGCAAAAAAAAGAAGGAATGGGG + Intergenic
1040635347 8:49266913-49266935 GGCCAACATAATACTGAATGGGG - Intergenic
1041969534 8:63722297-63722319 GGCAAAAATTTTAATGAATTTGG - Intergenic
1042432963 8:68728993-68729015 AACTTAAAAAATAATGAATTTGG + Intronic
1043095705 8:75968788-75968810 GACCAAAATAAAAATGATTTAGG - Intergenic
1043165922 8:76902316-76902338 GGCCAATAAAATACTAAATTCGG + Intergenic
1043264495 8:78246895-78246917 GGACAATAAAACAATGACTTTGG - Intergenic
1043329670 8:79099844-79099866 GGCGAAAAAAAATATGGATTTGG + Intergenic
1043630439 8:82324395-82324417 ATGCAAAAAAAAAATGAATTTGG - Intergenic
1043654640 8:82646944-82646966 GGCCAAATAAATAATTAAGAAGG + Intergenic
1044214337 8:89590612-89590634 CGCCAAAAAAAAAATCAATTTGG + Intergenic
1044925116 8:97202860-97202882 TGCCAAACAAATCATGAACTGGG - Intergenic
1045875153 8:106972913-106972935 GTGGAAAAAAATACTGAATTTGG + Intergenic
1046073549 8:109288156-109288178 GACAAAATAAACAATGAATTTGG + Intronic
1046433658 8:114160489-114160511 GGACAACAAAATTATGCATTTGG - Intergenic
1046882610 8:119326521-119326543 TGCCAAAAGAATAAGGAATTTGG + Intergenic
1046885473 8:119362188-119362210 AGCCAACAAAATGATGATTTTGG - Intergenic
1046954714 8:120051548-120051570 GGCCACAAAACTAATAAAGTGGG + Intergenic
1047104400 8:121717501-121717523 GCCAAAAAATATAATTAATTGGG - Intergenic
1048419766 8:134266432-134266454 GGCAAAAAAAATACAGAAATAGG - Intergenic
1048685554 8:136901305-136901327 CGTCACAAAAATAATGTATTAGG - Intergenic
1049028976 8:140018844-140018866 TGCCAGAAAAATAATGAATACGG + Intronic
1049172943 8:141173339-141173361 GGCCAAAAGAATAATTCATCGGG + Intronic
1049894566 9:101451-101473 GGCCAAATAAAGACTGGATTTGG - Intergenic
1050309382 9:4337386-4337408 GGTCAAAAAATTAATGACATAGG + Intronic
1051581670 9:18682710-18682732 GGCTTAAAAAATAAAGAAATGGG - Intronic
1051770810 9:20577271-20577293 GCACAAAAAAATCATGAAGTAGG + Intronic
1052394518 9:27922661-27922683 GGAAAAAAAAATACTAAATTAGG - Intergenic
1053044558 9:34904331-34904353 AGCCAAAATAATACTGAATGGGG - Intergenic
1053125693 9:35579128-35579150 GTACAAAAATAGAATGAATTAGG - Intergenic
1054910162 9:70447292-70447314 GGCTAAAACAAAAATTAATTTGG + Intergenic
1055278229 9:74643596-74643618 TGCCATAAAAATATTGAAGTAGG + Intronic
1056084417 9:83131306-83131328 GGGCAAAAAAATTATGAGATAGG + Intergenic
1056963727 9:91148761-91148783 GGATACAAAAATAATGAATGAGG + Intergenic
1057021547 9:91701725-91701747 AGCCATAAAAATAAGGAACTAGG - Intronic
1058969224 9:110064777-110064799 GGTCCCAAAAATAATGAATGAGG - Intronic
1059523943 9:114972247-114972269 GGACAAAAAAATGATAATTTGGG - Intergenic
1060120723 9:120987107-120987129 GAGGAAGAAAATAATGAATTTGG + Intronic
1060172500 9:121473504-121473526 GGACAAAAAAATGAGGCATTTGG + Intergenic
1060433035 9:123566835-123566857 GGCCAACAAAAAAAAGTATTTGG - Intronic
1060697438 9:125721419-125721441 GAAAAAAAAAATAATGAAATTGG + Intergenic
1203439692 Un_GL000195v1:177370-177392 AGCCTAAAAAATAATGAAATTGG - Intergenic
1185928970 X:4181006-4181028 GGCAAAATAAATAATTATTTTGG + Intergenic
1186044272 X:5517816-5517838 TTTCAAAAAAATAATGAGTTGGG - Intergenic
1186321724 X:8434664-8434686 AGCCAGAAAAATAATGAAATGGG + Intergenic
1186567428 X:10678619-10678641 GTCAAAAGAAATAATGAACTGGG + Intronic
1186986304 X:15017780-15017802 AGCCAAATAAAAAATGTATTTGG + Intergenic
1187113428 X:16324825-16324847 GTTCAAAAAATTAATGAATCCGG + Intergenic
1187304908 X:18086276-18086298 TGAAAAAAAAATTATGAATTTGG + Intergenic
1187751797 X:22474353-22474375 GGACAAAAATAGAATGAAATGGG + Intergenic
1188073365 X:25745166-25745188 GGACATAAAAATATTGAATGAGG + Intergenic
1188346239 X:29069516-29069538 AGACAACAAAATAATGGATTAGG - Intronic
1188536893 X:31206832-31206854 AGTCAAAGAGATAATGAATTTGG - Intronic
1189688968 X:43595544-43595566 CCTCAACAAAATAATGAATTCGG + Intergenic
1191080840 X:56508116-56508138 AGCCAACAAAATACTGAATGAGG + Intergenic
1192940728 X:75909170-75909192 GGTGAAAAAAATGATGAACTCGG + Intergenic
1193138219 X:77996881-77996903 AGCCAAAAAAAAAATCACTTTGG - Intronic
1193762229 X:85481182-85481204 GGACATAAAAATAATGAAAGGGG - Intergenic
1193787607 X:85778666-85778688 GAACAAAAAAGTAAGGAATTTGG - Intergenic
1193930926 X:87550889-87550911 AGCCAAAATAATACTGAATGGGG + Intronic
1194734023 X:97490952-97490974 GGCAAAAAAAAAAATCAATAAGG - Intronic
1194928147 X:99852889-99852911 GGCAAAAAAAAAAAAAAATTAGG - Intergenic
1195837904 X:109139696-109139718 CAACATAAAAATAATGAATTTGG + Intergenic
1195902016 X:109808842-109808864 GTGCAAAAAAAAAATGAAGTGGG + Intergenic
1195987659 X:110647899-110647921 GGCCAAAAATACAACAAATTTGG + Intergenic
1197472601 X:126881919-126881941 GGAAAAAAAAATAATTTATTGGG + Intergenic
1198666144 X:139025381-139025403 GGCCAGCAAAATATTGAAATTGG - Intronic
1199077598 X:143542247-143542269 GGCCAACATCATAATGAATGGGG + Intergenic
1199178301 X:144819404-144819426 GCCCCAAAAAAGAATGAATGTGG + Intergenic
1200183644 X:154167532-154167554 GGCCACAAAATTAAGGAATTTGG + Intergenic
1200189298 X:154204660-154204682 GGCCACAAAATTAAGGAATTTGG + Intergenic
1200195053 X:154242469-154242491 GGCCACAAAATTAAGGAATTTGG + Intergenic
1200200703 X:154279590-154279612 GGCCACAAAATTAAGGAATTTGG + Intronic
1200533008 Y:4359949-4359971 GGCCATGGAAATAAGGAATTGGG + Intergenic
1202032630 Y:20593881-20593903 GGCCAAAAATATACTGAACATGG - Intergenic
1202167048 Y:22000704-22000726 GTAAAAAAAAATAAGGAATTGGG + Intergenic
1202224312 Y:22585669-22585691 GTAAAAAAAAATAAGGAATTGGG - Intergenic
1202318802 Y:23609991-23610013 GTAAAAAAAAATAAGGAATTGGG + Intergenic
1202551966 Y:26060066-26060088 GTAAAAAAAAATAAGGAATTGGG - Intergenic