ID: 958443788

View in Genome Browser
Species Human (GRCh38)
Location 3:94190126-94190148
Sequence CTTCCAACACAGATAGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958443788_958443789 -8 Left 958443788 3:94190126-94190148 CCAGGTGCTATCTGTGTTGGAAG No data
Right 958443789 3:94190141-94190163 GTTGGAAGATTATTAACTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958443788 Original CRISPR CTTCCAACACAGATAGCACC TGG (reversed) Intergenic
No off target data available for this crispr