ID: 958446299

View in Genome Browser
Species Human (GRCh38)
Location 3:94219136-94219158
Sequence CTGCTCCTTAAACCTTGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958446299_958446301 5 Left 958446299 3:94219136-94219158 CCTGCTCAAGGTTTAAGGAGCAG No data
Right 958446301 3:94219164-94219186 GAGACTTCAGCTGGAAATGAAGG No data
958446299_958446300 -4 Left 958446299 3:94219136-94219158 CCTGCTCAAGGTTTAAGGAGCAG No data
Right 958446300 3:94219155-94219177 GCAGACAGTGAGACTTCAGCTGG No data
958446299_958446303 15 Left 958446299 3:94219136-94219158 CCTGCTCAAGGTTTAAGGAGCAG No data
Right 958446303 3:94219174-94219196 CTGGAAATGAAGGAGGCAAAAGG No data
958446299_958446302 8 Left 958446299 3:94219136-94219158 CCTGCTCAAGGTTTAAGGAGCAG No data
Right 958446302 3:94219167-94219189 ACTTCAGCTGGAAATGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958446299 Original CRISPR CTGCTCCTTAAACCTTGAGC AGG (reversed) Intergenic
No off target data available for this crispr