ID: 958446763

View in Genome Browser
Species Human (GRCh38)
Location 3:94225178-94225200
Sequence CCATGGTGCCTGGCAACAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958446760_958446763 -10 Left 958446760 3:94225165-94225187 CCTTGATCTTTCTCCATGGTGCC No data
Right 958446763 3:94225178-94225200 CCATGGTGCCTGGCAACAACAGG No data
958446757_958446763 -3 Left 958446757 3:94225158-94225180 CCCTGCTCCTTGATCTTTCTCCA No data
Right 958446763 3:94225178-94225200 CCATGGTGCCTGGCAACAACAGG No data
958446753_958446763 27 Left 958446753 3:94225128-94225150 CCCAGCTACTCATAGCATCCATT No data
Right 958446763 3:94225178-94225200 CCATGGTGCCTGGCAACAACAGG No data
958446758_958446763 -4 Left 958446758 3:94225159-94225181 CCTGCTCCTTGATCTTTCTCCAT No data
Right 958446763 3:94225178-94225200 CCATGGTGCCTGGCAACAACAGG No data
958446754_958446763 26 Left 958446754 3:94225129-94225151 CCAGCTACTCATAGCATCCATTT No data
Right 958446763 3:94225178-94225200 CCATGGTGCCTGGCAACAACAGG No data
958446756_958446763 2 Left 958446756 3:94225153-94225175 CCTCTCCCTGCTCCTTGATCTTT No data
Right 958446763 3:94225178-94225200 CCATGGTGCCTGGCAACAACAGG No data
958446755_958446763 9 Left 958446755 3:94225146-94225168 CCATTTTCCTCTCCCTGCTCCTT No data
Right 958446763 3:94225178-94225200 CCATGGTGCCTGGCAACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958446763 Original CRISPR CCATGGTGCCTGGCAACAAC AGG Intergenic
No off target data available for this crispr